ID: 1185270430

View in Genome Browser
Species Human (GRCh38)
Location 22:49927065-49927087
Sequence CAGATGAGAGATGAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 544}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270430_1185270436 -6 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270436 22:49927082-49927104 CATCTGCTTTGTGGGAAACGGGG 0: 1
1: 0
2: 3
3: 8
4: 167
1185270430_1185270444 29 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 70
1185270430_1185270435 -7 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270435 22:49927081-49927103 TCATCTGCTTTGTGGGAAACGGG 0: 1
1: 1
2: 0
3: 23
4: 301
1185270430_1185270442 28 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270442 22:49927116-49927138 GCCCTTGGATGGCTGCGTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 132
1185270430_1185270438 13 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270438 22:49927101-49927123 GGGGGTCTCCGAGCTGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1185270430_1185270441 27 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270441 22:49927115-49927137 TGCCCTTGGATGGCTGCGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
1185270430_1185270437 -5 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270437 22:49927083-49927105 ATCTGCTTTGTGGGAAACGGGGG 0: 1
1: 1
2: 0
3: 8
4: 143
1185270430_1185270434 -8 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270434 22:49927080-49927102 CTCATCTGCTTTGTGGGAAACGG 0: 1
1: 0
2: 1
3: 29
4: 283
1185270430_1185270439 17 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270439 22:49927105-49927127 GTCTCCGAGCTGCCCTTGGATGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270430 Original CRISPR CAGATGAGAGATGAGGCAGA CGG (reversed) Intronic
900695020 1:4004419-4004441 CAGATAAGACCTAAGGCAGAGGG - Intergenic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
901573316 1:10179627-10179649 CATATTGGAGATGAAGCAGAAGG + Intronic
901599444 1:10411415-10411437 CAGGTGGGAGATGAGGGAGCAGG + Exonic
902225410 1:14993620-14993642 CAGACGAGAGTCGAGGCAGCAGG - Intronic
902412825 1:16221401-16221423 CAGATGAGTGAGCAGGCAGTAGG + Intergenic
902618236 1:17635459-17635481 CAGCAGAGAGAAGGGGCAGAGGG - Intronic
903325269 1:22565582-22565604 GAGAAGAGAGTTGAGGCAGGGGG - Intronic
903374517 1:22857487-22857509 CAGATGAGAGAGGTGACAGATGG + Intronic
903857418 1:26345228-26345250 CGGGTGGGAGATGAGGCAGCAGG + Exonic
904343944 1:29856076-29856098 CAGAGGAGACATGGGGCAAAAGG + Intergenic
904856272 1:33500290-33500312 TAGGTGAGAGATGCGGCACACGG - Intergenic
904920119 1:34000916-34000938 GAGAAGAGAGAGGAGGTAGAAGG + Intronic
904977567 1:34469794-34469816 AAGCTGAGAGATGTGGAAGAAGG - Intergenic
905003243 1:34689921-34689943 CAGAAGAGTGATAAGACAGATGG - Intergenic
905041599 1:34964518-34964540 GAGAGGAGAGATGGGGCAGATGG - Intergenic
905232712 1:36524903-36524925 CAGATGAGAAAATAGGCAGCAGG - Intergenic
905919516 1:41710160-41710182 CAGATGAGAAATGTGGCAGGAGG - Intronic
906061190 1:42949778-42949800 CAGATGAGAAATGAGAGAGAGGG + Intronic
906195412 1:43927529-43927551 CAGAGGAGTGATGAGGACGAGGG + Intronic
906418318 1:45640494-45640516 CAGCTGACAGTTGAGACAGAGGG + Intronic
906946189 1:50296348-50296370 GAGATGAGAGAAGAGGAAGAGGG - Intergenic
908670794 1:66545241-66545263 CCAGTGAGAGATGAGGCTGAAGG - Intronic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
909994500 1:82262368-82262390 AAGGAGAAAGATGAGGCAGAAGG - Intergenic
910432238 1:87170242-87170264 GAGATGAGGGATGAGACAAAGGG + Intergenic
910770439 1:90825573-90825595 CAGATGAGAGCAGCAGCAGAAGG - Intergenic
912697359 1:111851485-111851507 CAGATGAGTTTTGGGGCAGAAGG - Intronic
913077266 1:115351574-115351596 CAGGTGAGAGATGAAGATGATGG - Intergenic
913518278 1:119623347-119623369 CAGATGCGAGCTGAGGCTGAAGG + Exonic
914196794 1:145451907-145451929 AAGATGGGAGAGGAGGGAGAGGG + Intergenic
914585758 1:149060337-149060359 CAGATGAGGGATGGGTCAGTGGG - Intronic
914943981 1:152047674-152047696 CAGCTGGGAAATGAGGCACAAGG - Intronic
915211486 1:154312925-154312947 AAGAGGAGAGATGAGGAACAGGG - Intergenic
915212619 1:154321902-154321924 AAGAGGAGAGATGAGGAACAGGG - Intronic
915480074 1:156178406-156178428 GAGATGAAAGATGAGGAAGTGGG - Intergenic
915664751 1:157434354-157434376 GAGAGAAAAGATGAGGCAGATGG - Intergenic
915986887 1:160475083-160475105 CATATAGGAGATGAGGAAGAGGG - Intergenic
916830970 1:168490784-168490806 GAGATGAGAGATAATTCAGAAGG + Intergenic
917444982 1:175099477-175099499 AAGAGGAGAGATGAGGCATCAGG + Intronic
917706879 1:177643672-177643694 CAGGTGAGAGATGAGGAAATTGG + Intergenic
919862975 1:201754658-201754680 CTCATGAGTGATGAGGCAGCAGG + Intronic
921154048 1:212424662-212424684 CCAATGAGAGCTGTGGCAGAAGG - Intergenic
921176457 1:212599557-212599579 CAGAGGAGAGAGGAGAGAGAGGG - Intronic
921302234 1:213762297-213762319 CAGAAAGGAAATGAGGCAGAGGG - Intergenic
922323826 1:224510486-224510508 AAGCTGAGAGCTGAGGCAGGAGG + Intronic
922439593 1:225642432-225642454 TAAGTGAGCGATGAGGCAGAGGG + Intronic
923877215 1:238062431-238062453 CAATTCAGAGATGAGTCAGAAGG - Intergenic
924239112 1:242024419-242024441 CAACTGAGAAATGAGGGAGAAGG - Intergenic
924517605 1:244779713-244779735 CAGATGAGAGAGAGGGGAGAGGG - Intergenic
1064156888 10:12909791-12909813 CAGATTAGAGATGGGTCAGGTGG - Intronic
1065040894 10:21695003-21695025 AAAGTGAGAGATGCGGCAGAAGG - Intronic
1065880754 10:30035899-30035921 GAGATGAGAGATGGGGCTGTTGG - Intronic
1066698772 10:38104153-38104175 CAGATGAGAAAAGCAGCAGATGG - Intronic
1066993875 10:42544065-42544087 CAGATGAGAAAAGCAGCAGATGG + Intergenic
1067031755 10:42882791-42882813 CAGCTGAGTGAGGAGGCAGGAGG + Intergenic
1068001055 10:51334822-51334844 TAGAGGAGAGCAGAGGCAGAGGG + Intronic
1068072240 10:52209735-52209757 GAGATGGGTGATGAGGGAGAAGG - Intronic
1068831090 10:61495758-61495780 CAGAGGAGAGATGAGGCAAAAGG + Intergenic
1069071507 10:63994607-63994629 CAGATGAAAGCTGAGTCTGAAGG - Intergenic
1069375450 10:67788430-67788452 AAGATGAGAGAGGAGGGAGATGG + Intergenic
1070668644 10:78362858-78362880 CAGGGGTGAGATGAAGCAGAGGG + Intergenic
1070737606 10:78875017-78875039 GAGAAGAGAGATGAGGGAGGTGG - Intergenic
1071882538 10:89915078-89915100 CTGATGAGAGCTGAGGCACATGG + Intergenic
1071993319 10:91122393-91122415 GGGATGAGAGAAGAGGGAGAAGG + Intergenic
1072161202 10:92768607-92768629 CTGCTGAGAGATGAGAGAGAGGG + Intergenic
1073548982 10:104379942-104379964 TATGTTAGAGATGAGGCAGAGGG + Intronic
1074114249 10:110443806-110443828 GTGATGGCAGATGAGGCAGAAGG - Intergenic
1074125480 10:110525741-110525763 CAGATGAAAGACCCGGCAGAAGG - Intergenic
1074153045 10:110775581-110775603 CTGCTGAGAGAGGAGGCAGCAGG - Intronic
1074345833 10:112685467-112685489 GAGATAAGAGATGAGGCAATAGG - Intronic
1074541782 10:114371160-114371182 ATGAGGAGAGATGAGACAGAAGG - Intronic
1074554419 10:114475152-114475174 CAGGTGAGAGACGAGGTAGGAGG - Intronic
1075359125 10:121813809-121813831 CAGATGAGAGAGCAGGGAGCTGG - Intronic
1075857467 10:125642127-125642149 GAAAGGAGAGAAGAGGCAGAAGG + Intronic
1076273198 10:129174571-129174593 CAAATGAGGGAGGAGGGAGAGGG + Intergenic
1076328515 10:129646935-129646957 CAGATGCGAGACGGGCCAGAGGG - Intronic
1076528346 10:131126894-131126916 CAGACAAGAGCTGAGGGAGACGG + Intronic
1077022520 11:424718-424740 CAGATGAGAACTCAGGGAGAAGG + Intronic
1077415825 11:2423853-2423875 CAGCTGACAGATGAGGCTGTGGG - Intergenic
1078145974 11:8722058-8722080 CAGATGTGAGATGGGACAGGCGG + Intronic
1078438329 11:11343978-11344000 CAAATGAGAGATGATGACGACGG - Intronic
1079088719 11:17465578-17465600 CTGATGAGAGAAGAGGGAAAAGG + Intronic
1079243154 11:18734998-18735020 CAGATTACAGATAAGGCACAGGG - Intronic
1079320491 11:19447860-19447882 GATATGAGAGATGAGGCACAGGG + Intronic
1079417618 11:20254217-20254239 GAGAAGACAGTTGAGGCAGAGGG + Intergenic
1079863637 11:25707018-25707040 AGGAAGTGAGATGAGGCAGAGGG - Intergenic
1079995769 11:27293600-27293622 GAGAGGGGAGAGGAGGCAGAGGG + Intergenic
1080564637 11:33496841-33496863 AAGATTAGAAAGGAGGCAGAAGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081116935 11:39214119-39214141 CATATGGGATATGAGGCACAAGG - Intergenic
1081527728 11:43938060-43938082 CAGATGAGAGTTTAGACACATGG + Intronic
1081779464 11:45699913-45699935 GAGATGAGAGATGTTCCAGAGGG + Intergenic
1083880460 11:65545901-65545923 CAGATCAGAGGTGAGACAGAGGG - Intronic
1084022090 11:66423809-66423831 GAGAGGAGAGAAGAGGCAGCTGG - Intronic
1084028881 11:66469123-66469145 CAGATGGGGGAGGAGGAAGAGGG - Intronic
1084100904 11:66948389-66948411 CTGAAGAGTGAGGAGGCAGAGGG + Intronic
1084860020 11:72012162-72012184 CAAATGAGAGAAGGTGCAGAAGG + Intronic
1085122564 11:73976621-73976643 CAGGTGAGTCATGAGGTAGACGG - Exonic
1085375112 11:76053402-76053424 CAATTGAGAAACGAGGCAGATGG - Intronic
1085904633 11:80745637-80745659 GAGGTGAGAGCTGAGGCTGATGG + Intergenic
1086351828 11:85950095-85950117 CAGATGAAAAAACAGGCAGAGGG + Intergenic
1086458653 11:86984101-86984123 GAGATGGGAGATGAAGCAGGAGG + Intergenic
1086892449 11:92273329-92273351 GAGGAGGGAGATGAGGCAGAAGG - Intergenic
1087605652 11:100374399-100374421 CAGATGAAAGAGGATGAAGAGGG - Intergenic
1087654872 11:100910331-100910353 AAGATGAGAAGTGAGGTAGAAGG - Intronic
1088136115 11:106557320-106557342 CAGATGACAGAGGAGACAAATGG - Intergenic
1088964887 11:114708978-114709000 GAGGTGAGAGATGAGGGAGAAGG - Intergenic
1089069699 11:115689875-115689897 CAGCGGAGACATGAGGGAGAAGG + Intergenic
1089312155 11:117565715-117565737 CAGCTGAGTGCTGAGGGAGAGGG - Intronic
1089313614 11:117575956-117575978 CAGAATAGAGAGGATGCAGAGGG + Intronic
1089377331 11:118003863-118003885 CACATGAAGGATGAGGCAGGAGG + Intergenic
1089480660 11:118802346-118802368 CAGATGAGAGAACAGGCATAGGG - Intergenic
1089555132 11:119311952-119311974 GGGATGAGAGATGGGTCAGAGGG + Intronic
1090494172 11:127193603-127193625 CATTTCAGAGATGAGGCAGCAGG + Intergenic
1091064268 11:132493885-132493907 CAGATGAGAAAAGATGCACATGG - Intronic
1091270021 11:134302074-134302096 CAGAGGAGAGAGGAGCCAGGTGG - Intronic
1091472070 12:737584-737606 TAGATGAGGGAAAAGGCAGAGGG + Intergenic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092587140 12:9911162-9911184 TAGATGAGTGATGGGGGAGAAGG + Intronic
1092698340 12:11199437-11199459 CAGATGGGGGCTGAGGTAGAGGG - Intergenic
1093800514 12:23366611-23366633 GAGAGGAGAGCTGAGGCAGAGGG - Intergenic
1094042425 12:26132067-26132089 TTGTTGAGAGATGAGGAAGATGG + Intronic
1094083806 12:26566366-26566388 GAGAGGAGAGGAGAGGCAGAGGG + Intronic
1095858155 12:46884829-46884851 CTGGGGAGAGATGAGGCAAAGGG - Intergenic
1096109884 12:49022260-49022282 CAGGTGAGAGATGACGAGGAAGG - Exonic
1096870813 12:54590933-54590955 CGGAGGAGAGAGGAGGGAGAGGG + Intergenic
1098029205 12:66236945-66236967 CAGATGAAAGACTAGGGAGAGGG - Intronic
1098448557 12:70592979-70593001 GCGATAAGAAATGAGGCAGATGG - Intronic
1098832243 12:75376655-75376677 CTGATGAGGGATGAGGCTGGGGG - Intronic
1099014429 12:77327038-77327060 CAGAGAATAGATCAGGCAGAAGG + Intergenic
1099426923 12:82534973-82534995 CAAAGAAGAGATGCGGCAGAAGG + Intergenic
1100461475 12:94804179-94804201 CAGCTCCGAGATGAGGCAGCTGG + Intergenic
1101135862 12:101742472-101742494 CAGATTAGAGATGGTGCAGGTGG - Intronic
1102184906 12:110940454-110940476 CAGCTGAGAGGTGAGCCTGATGG - Intergenic
1103642251 12:122361011-122361033 GAGCTGAGGGAAGAGGCAGAAGG + Exonic
1104233518 12:126908751-126908773 CAGATGACAGATAAGGAAGGAGG + Intergenic
1104870659 12:131993051-131993073 CAGATGAGTGAGGAGCCTGAGGG + Intronic
1104993372 12:132639471-132639493 CAGATGAGGCATGAGGGTGAAGG - Intronic
1105249038 13:18679733-18679755 GAGATGAGAGAGAAGCCAGAGGG + Intergenic
1106307141 13:28522707-28522729 ATGATGGGAAATGAGGCAGAGGG + Intergenic
1107361015 13:39618065-39618087 AAGAAGAGAGAGGAGGAAGATGG + Intergenic
1107420655 13:40243201-40243223 CAGCTGAGAGATCAGGGAGATGG + Intergenic
1108119666 13:47170973-47170995 CAAAAGAGAGATGAGGGAGTGGG + Intergenic
1108522593 13:51259395-51259417 CAGATGAGGGGAGAGGCAGGAGG - Intronic
1108571350 13:51754954-51754976 GAAATGAGAGATGAGGCTGGAGG - Intronic
1109306010 13:60642678-60642700 CACATGAGAGATGAAGGCGAGGG + Intergenic
1109327889 13:60891652-60891674 CAGAGCAGAGCTGAGGAAGATGG - Intergenic
1110774560 13:79393437-79393459 CCGAGGAGACATAAGGCAGAAGG - Intronic
1111059614 13:82998998-82999020 CAGAAGAGTGATGTGGGAGAGGG - Intergenic
1111431548 13:88152785-88152807 CAGGTGTCACATGAGGCAGATGG + Intergenic
1112062588 13:95755911-95755933 CAGAAGAGAGGTGGGGAAGAGGG - Intronic
1113091343 13:106619864-106619886 GAGATGACAGAGGAAGCAGAAGG + Intergenic
1113782065 13:112982504-112982526 CAGGTGGGAGGTGCGGCAGATGG + Intronic
1114183767 14:20385009-20385031 TAGATGAGAGCTTGGGCAGAGGG + Exonic
1114402456 14:22422490-22422512 CAGAGGAGGGACCAGGCAGAAGG + Intergenic
1115729628 14:36254654-36254676 AAGTTCAGAGATGAGGTAGAAGG + Intergenic
1116536938 14:46043174-46043196 TAGAAGAGAGATGTGACAGAAGG + Intergenic
1117107037 14:52408222-52408244 CAAATGTGAGGTAAGGCAGAAGG + Intergenic
1117152265 14:52901551-52901573 AAGAAGAGAGATGAGACAGAAGG + Intronic
1117685278 14:58246751-58246773 TAGACGAGAGAAGAGGTAGAAGG - Intronic
1117932310 14:60855917-60855939 GAGATGAGAGATGGGGCAATTGG - Intronic
1118024249 14:61752861-61752883 CGGATCAAAGATGAGTCAGATGG - Intergenic
1118525898 14:66642295-66642317 CAGAATAGAGATGCAGCAGAAGG + Intronic
1119625928 14:76175378-76175400 CAGAAGAGAGATGGGGGAGGGGG - Intronic
1120759160 14:88270673-88270695 CAGATGTGAGATGAGGTGGCAGG - Intronic
1120942602 14:89963196-89963218 CAGAGAAGAGAAGAGGTAGATGG - Exonic
1120979316 14:90276785-90276807 GAGAAGAGACATGAGTCAGATGG + Exonic
1121001000 14:90451990-90452012 CATTTGACAGATGAGGCACAGGG - Intergenic
1121219979 14:92277933-92277955 CAGATGAGAGGTGAGGAGGCTGG + Intergenic
1121413662 14:93764194-93764216 CCTCTGAGAGATGAGCCAGAGGG - Intronic
1121872598 14:97422808-97422830 CAGAATACAGATGAAGCAGAGGG + Intergenic
1122020041 14:98830225-98830247 GAGATGAGAGGAGAAGCAGAAGG - Intergenic
1122311565 14:100799469-100799491 CAGATGAGAAAACAGGCAAAAGG + Intergenic
1122415034 14:101545323-101545345 TACAGGGGAGATGAGGCAGATGG + Intergenic
1124044847 15:26139267-26139289 CAGCTGAGAGCTGAGGTTGATGG - Intergenic
1124136740 15:27042167-27042189 CTGCTGAGAGGGGAGGCAGATGG - Intronic
1124794045 15:32759550-32759572 CAGTTGAGAGACGAGGAAGTGGG + Intergenic
1125138428 15:36372297-36372319 CATTTTAGAGATGAAGCAGAGGG - Intergenic
1125654093 15:41341600-41341622 AACATGAGAGTTGAGGAAGAGGG - Intronic
1125767860 15:42147104-42147126 GAGGTGAGAGAAGAGCCAGAAGG - Exonic
1127539395 15:59921966-59921988 CAGAAGAGGGCTGAGGCAGATGG + Intergenic
1127943401 15:63724785-63724807 CAAATGGGAGATGCTGCAGAAGG + Intronic
1128223193 15:65982891-65982913 CAGAGGAGAGGGGTGGCAGATGG - Intronic
1128405934 15:67338893-67338915 AAGATGAGAGATGAGAGCGAAGG - Intronic
1128611867 15:69080463-69080485 CACATGAGAGATGAGGGAAGAGG - Intergenic
1128752400 15:70158866-70158888 GAGATGGGAGAGGAGGCAGTGGG + Intergenic
1128822105 15:70666412-70666434 CATATGAAAGATGGGGAAGAGGG - Intronic
1128907086 15:71476880-71476902 CAGATAACTGATGAGGCAGCTGG - Intronic
1129696256 15:77742098-77742120 AAGATGAGAGGCCAGGCAGAGGG + Intronic
1129872323 15:78948424-78948446 CAGAGGGGGGATGAGGCAGGTGG + Intronic
1130027599 15:80283239-80283261 CAGGTGGGAGATGAGACACATGG + Intergenic
1130430475 15:83842212-83842234 CAGATGGATGAGGAGGCAGAAGG + Intronic
1130555545 15:84920066-84920088 CAGAAGAGAGATTAGGCAAAGGG + Intronic
1130932130 15:88437046-88437068 CACATGTGGGAGGAGGCAGAGGG - Intergenic
1130971456 15:88736951-88736973 AAGAAGAGAGAGGAGGCTGAAGG - Intergenic
1131688832 15:94804369-94804391 TACATGTGAGAAGAGGCAGAGGG - Intergenic
1131784834 15:95901163-95901185 CAGAAGAGAGATGAGGCCACAGG - Intergenic
1132468789 16:90252-90274 CAAAGAAGAGAGGAGGCAGAGGG - Intronic
1133071484 16:3249491-3249513 CAGACTGCAGATGAGGCAGATGG + Exonic
1134098608 16:11436017-11436039 AAGAGGAGAAATGAGACAGAGGG + Intronic
1134197239 16:12168655-12168677 GTGATGAGAGATGAAGCAAAGGG - Intronic
1135164481 16:20126594-20126616 CAGTTGAGAGAGGAGACAGGAGG + Intergenic
1135277401 16:21125442-21125464 GAGCTCAGTGATGAGGCAGATGG + Intronic
1136128574 16:28203717-28203739 GAGTTAAGAGATGAGGAAGAAGG - Intronic
1136399044 16:30007897-30007919 CAGATGGGAATTGAGGCATAGGG - Intronic
1137376409 16:47955775-47955797 CAGAGGAAAGATCTGGCAGAAGG + Intergenic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139366257 16:66435303-66435325 CAGATGAGAGAACAGGCTCAGGG - Intronic
1140021845 16:71246522-71246544 CAGATGAGAGAGGAGCCAAAGGG + Intergenic
1140122457 16:72095422-72095444 CAGCACAGAGATGGGGCAGAAGG - Intronic
1140677602 16:77348572-77348594 GGGATGAGAGAAGAGGCAGAGGG + Intronic
1141503579 16:84460874-84460896 CAGATGTGAGCTGTGGCAGGAGG - Intronic
1141757783 16:86004019-86004041 CTGGAGAGAGAGGAGGCAGAAGG + Intergenic
1142178537 16:88656175-88656197 CAGATGGGAGAGCAGGCCGACGG - Exonic
1142612259 17:1115567-1115589 TAGAACAGAGAGGAGGCAGAGGG - Intronic
1142902878 17:3024179-3024201 AAGATGAGAGAAGAGGAGGAGGG + Intronic
1143432041 17:6894600-6894622 AAAATGAGAGATGAGGGAGATGG + Intronic
1144278700 17:13702566-13702588 CTGATGAGAGATTTGGCAGTAGG - Intergenic
1144402535 17:14919997-14920019 CAGATTAGAGAGGATGCGGAGGG + Intergenic
1144793604 17:17876289-17876311 CAGATGAGAAGTGACGCAGCAGG + Intronic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1146083716 17:29807616-29807638 CAGAAGAGAGATGAAGAAAAGGG + Intronic
1146442702 17:32910942-32910964 GAGATAAGAGATGGGGAAGAGGG - Intergenic
1146942774 17:36855291-36855313 CTGATGGGAGATGAGGCTGGAGG - Intergenic
1147139754 17:38454285-38454307 CACTTGAGAGATGGGGCTGAGGG + Intronic
1147263397 17:39221791-39221813 CAGCTGAGAGGTGAGGGTGATGG - Intronic
1147970129 17:44214888-44214910 CAGATGGGACACGAGGAAGATGG - Intronic
1148330727 17:46812411-46812433 GAGCTGAGAGATGATTCAGAAGG - Intronic
1148579466 17:48733649-48733671 CAGAGGAGAGAAAATGCAGACGG - Intergenic
1149528094 17:57373637-57373659 CAGATGACAGAAGAGACAGTAGG - Intronic
1150629454 17:66868878-66868900 GAGATGAGAGAGGAGACAGGAGG + Intronic
1150668360 17:67167156-67167178 CAGATGAGAGATGTCCCAGGAGG + Intronic
1151271554 17:73000247-73000269 GAGATGAGAGGAGAGGGAGAAGG - Intronic
1153451360 18:5233106-5233128 AAGAAGAAAGGTGAGGCAGAGGG - Intergenic
1153721106 18:7904405-7904427 AAGATGAGACAGGAGGGAGATGG - Intronic
1154031557 18:10757598-10757620 AAGATGGGGGATGAGGAAGAGGG + Intronic
1154038127 18:10826419-10826441 TAGATGGCAGATGAGGCAGCAGG - Intronic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1157308000 18:46530885-46530907 AAGATGAGAGCTGAGGAATATGG - Intronic
1157331708 18:46708761-46708783 CAGATCAGTAAGGAGGCAGAGGG - Intronic
1157439535 18:47700011-47700033 GCGAGGAGAGATGAGGCTGAAGG + Intergenic
1158009000 18:52706966-52706988 CAGGAGAGAAATGATGCAGAGGG + Intronic
1158873354 18:61710003-61710025 CTGATGAGAGCTGTGGCAGAAGG - Intergenic
1159127470 18:64240955-64240977 CACATGAGAAAGGAGTCAGATGG - Intergenic
1159480284 18:68981374-68981396 AAGAAGAGACATGAGGCATAAGG + Intronic
1159497501 18:69224927-69224949 CAGATGAGAAACTAGGCAGCAGG + Intergenic
1159599897 18:70419043-70419065 CACGTGGGAGATGAGACAGAAGG + Intergenic
1160310918 18:77789318-77789340 CAGGTGAGAGCAGAGGCACAAGG - Intergenic
1160975396 19:1790221-1790243 GGGAGGAGAGAGGAGGCAGAGGG - Intronic
1164415738 19:28045267-28045289 CAGATGAGAGGTGAGCTGGAAGG - Intergenic
1164749958 19:30646169-30646191 GGGATGAAAGAAGAGGCAGAGGG - Intronic
1164881182 19:31734125-31734147 CAGAGGGGAGAGGAAGCAGAGGG - Intergenic
1165796598 19:38523523-38523545 GAGATGAGAGAAGAGGGAGATGG - Intronic
1165987237 19:39780480-39780502 GATTTGAGAGATGAGGCACAGGG - Intronic
1166344216 19:42155393-42155415 CAGATGGGAGTGGAGGGAGAGGG - Intronic
1166439410 19:42798267-42798289 AAGATGAGAAAAGAGGCTGAGGG + Intronic
1166443068 19:42833164-42833186 CAGATGAGGAAAGAGGCTGAGGG + Intronic
1166450850 19:42899578-42899600 CAGATGAGGAAAGAGGCTGAGGG + Intronic
1166467777 19:43048243-43048265 AAGATGAGAAAAGAGGCTGAGGG + Intronic
1166468898 19:43060381-43060403 CAGATGAGGAAAGAGGCTGAGGG + Intronic
1166474393 19:43109034-43109056 AAGATGAGAAAAGAGGCTGAGGG + Intronic
1166488361 19:43234109-43234131 AAGATGAGAAAAGAGGCTGAGGG + Intronic
1166489862 19:43249433-43249455 CAGATGAGGAAAGAGGCTGAAGG + Intronic
1166525291 19:43506839-43506861 CAGAAGTGAGATCAGGCAGTGGG + Exonic
1167408893 19:49333490-49333512 AAGCTGAGGGATGAGGCAGGTGG + Intergenic
1167420064 19:49397548-49397570 CAGGTGAGGGTGGAGGCAGATGG + Intronic
1167455284 19:49594564-49594586 GAGAGGAGAGAGGAGGCGGAGGG - Exonic
1167747068 19:51358135-51358157 CACATGGGAGAAGAGGAAGAGGG - Intronic
1168000529 19:53442209-53442231 CACATTGCAGATGAGGCAGATGG + Intronic
1168005025 19:53479693-53479715 CACATTGCAGATGAGGCAGATGG + Intronic
925089063 2:1138540-1138562 CAGCTGAGAGATGAGGTGGAGGG + Intronic
925586870 2:5473706-5473728 GAAATCAGAGATGAGGCTGATGG - Intergenic
925635493 2:5937936-5937958 CACTTTACAGATGAGGCAGAGGG + Intergenic
925839099 2:7974348-7974370 CATATGAGAGATGATGGTGAAGG + Intergenic
925928011 2:8684636-8684658 CAGATGTGTGGTAAGGCAGAGGG + Intergenic
926059160 2:9794470-9794492 GAGATCAGAGATGGGGGAGAGGG - Intergenic
926195353 2:10760517-10760539 CATGTGAGAGATGAGGAAGAAGG + Intronic
926452331 2:13020536-13020558 GAGATGTGAGATGTGGGAGATGG - Intergenic
926473019 2:13285065-13285087 CAGCAGAGAGGGGAGGCAGAGGG + Intergenic
926919628 2:17927601-17927623 CAGATGAGAGATGAGCAAAGGGG + Intronic
927300283 2:21504375-21504397 TAGAGGAAAAATGAGGCAGAAGG - Intergenic
927431059 2:23026429-23026451 AAGAAGAGAGAGGAGACAGATGG + Intergenic
928861518 2:35862722-35862744 CATATGATAGAAGAGGTAGAAGG - Intergenic
929392513 2:41486917-41486939 AAGATGAGAGAAGTGGTAGAAGG - Intergenic
930470656 2:51807840-51807862 CAGCTGAGGAAAGAGGCAGAAGG + Intergenic
930501012 2:52217515-52217537 AAGATGAAAGATGTGTCAGAAGG - Intergenic
930835210 2:55785574-55785596 GATGTGAGAGATGAGGGAGAAGG - Intergenic
931264462 2:60648058-60648080 AAGGTGAGAGATGAGGGAGGGGG + Intergenic
931347026 2:61455990-61456012 CAGAGTACAGATGAGGCAGTAGG - Intronic
931488077 2:62713567-62713589 GAGGGGAGAGATGGGGCAGAAGG + Intronic
931615086 2:64147566-64147588 CAGATGAAAGATGGGTCAGAGGG + Intergenic
931960258 2:67474275-67474297 CAGCCGAGAAATGATGCAGAAGG - Intergenic
932188180 2:69716393-69716415 AAGATAAGAGGAGAGGCAGAGGG + Intronic
932498165 2:72157863-72157885 CAGGTGATAGGTGAGGGAGAGGG + Intergenic
932714485 2:74091436-74091458 CACTTTACAGATGAGGCAGATGG + Intronic
932747997 2:74350548-74350570 CAGCTGAGGGCTGAGGCAGGAGG + Intronic
933650492 2:84846466-84846488 CAGCTAAGTGATGAGGTAGAAGG + Intronic
933893887 2:86793344-86793366 CAAATGGGAGATGAGGGAGTTGG + Intronic
934140523 2:89042793-89042815 CACCTGAGAGATGAGGAAGCTGG - Intergenic
934228712 2:90157743-90157765 CACCTGAGAGATGAGGAAGCTGG + Intergenic
934233377 2:90207276-90207298 CACCTGAGAGATGAGGAAGCTGG + Intergenic
934758495 2:96840524-96840546 GAGATGGAAGATTAGGCAGAGGG + Intronic
935635514 2:105246920-105246942 CATTTCAGAGATGAGGCAGGTGG - Intergenic
935795229 2:106634541-106634563 AAGATGAGGGAGGAGGAAGAAGG - Intergenic
936598047 2:113868184-113868206 CAGATGGGAGAAGAGGAAAAGGG - Intergenic
937252935 2:120535453-120535475 CAGAGGAGAACTGAGGCAAAAGG + Intergenic
937873447 2:126802902-126802924 CAGAAGCGAAAAGAGGCAGAAGG + Intergenic
938120688 2:128631208-128631230 CAGGTGAAACGTGAGGCAGACGG - Intergenic
938158079 2:128958478-128958500 CAGAAAAGAAATGAGACAGAGGG + Intergenic
938776156 2:134543322-134543344 CTGATGAGAGTTAAGGCAGAAGG - Intronic
939126329 2:138181876-138181898 CAGATGAGGGAAGTAGCAGAGGG + Intergenic
939345665 2:140963934-140963956 CAGATAAGAGAAAAGGCAGCTGG + Intronic
939889945 2:147724423-147724445 CAGCTCAGGGATGAGGCAGGTGG - Intergenic
939964496 2:148597103-148597125 GAGATGAGAGATGGTGAAGATGG + Intergenic
940077293 2:149756812-149756834 CAGAGGACAGATGAAGCAGAGGG + Intergenic
940537205 2:154960353-154960375 CAGATGAGGGAATAGCCAGACGG + Intergenic
942387565 2:175458640-175458662 CTGAAGAGAGAACAGGCAGAAGG + Intergenic
943464375 2:188210367-188210389 CAGATGAGAGAAAATGCAGTAGG + Intergenic
944290466 2:197998710-197998732 CTGTGGAGAGTTGAGGCAGAAGG - Intronic
944686477 2:202122254-202122276 CAGACAAGAGAAAAGGCAGAGGG + Intronic
944856547 2:203773521-203773543 TAGATGGGAGAAAAGGCAGATGG + Intergenic
944862521 2:203828573-203828595 CAGAAGAGAAATGAGGCAGAAGG - Intergenic
944919428 2:204395769-204395791 GAGAAGAGAGATGAGGAAAAGGG + Intergenic
946191968 2:218012164-218012186 TAGATAAGACATGAGACAGAAGG + Intergenic
946276289 2:218634215-218634237 CAGATGGGTGAGGAGGCAGCAGG + Exonic
946642181 2:221795978-221796000 GAGATGGGAGATGAGGCACCAGG + Intergenic
947082004 2:226409494-226409516 CAGCTGAAATATGAGGGAGAAGG - Intergenic
947848279 2:233263246-233263268 CAGAAGACAGATGAGGAAAAGGG - Intronic
948917233 2:241040503-241040525 CAGGTGTGAGGTGAGTCAGATGG - Intronic
1168873191 20:1148371-1148393 CAGAGGACAGATGAAGCAAAAGG - Intronic
1169430860 20:5534876-5534898 CACAGGAGAGATGAGGCTGCAGG + Intergenic
1170717584 20:18845361-18845383 CAGTTGAGGGATGAGGAAGCTGG + Intergenic
1171417289 20:24991871-24991893 AAGATGGGAGAGGAGGCAAAGGG + Intronic
1172625505 20:36344436-36344458 CAGATGAGGCATGTGGTAGATGG - Intronic
1172652637 20:36514914-36514936 GAGAGGTGAGGTGAGGCAGATGG + Intronic
1172700605 20:36851586-36851608 CAGTGGAGACTTGAGGCAGAAGG - Intronic
1172772761 20:37391252-37391274 CAGATGAAAGAGGAGGCTGCAGG - Intronic
1173143214 20:40502896-40502918 CAGAAGAGACATCAGGCAAAGGG + Intergenic
1173239517 20:41281897-41281919 CAGCTGAGAGAGAAGGCAGAAGG + Intronic
1173384955 20:42578710-42578732 CAGATCCGAGATAGGGCAGATGG - Intronic
1174079044 20:47957952-47957974 CAGATGGGAGAGGAGGAAGGAGG + Intergenic
1175502629 20:59461199-59461221 CAGGTCTGAGATGAGGCAGTGGG + Intergenic
1175538913 20:59736131-59736153 CAGATGATGGATGGGGCAGCTGG - Intronic
1175571529 20:60026440-60026462 CAGAAGGGAGGTGAGGCAGAAGG + Intronic
1175804608 20:61820570-61820592 CAGAGGGGAGCTGAGGCGGAGGG + Intronic
1176455899 21:6910274-6910296 GAGATGAGAGAGAAGCCAGAGGG + Intergenic
1176834073 21:13775322-13775344 GAGATGAGAGAGAAGCCAGAGGG + Intergenic
1176916876 21:14636289-14636311 GAGATGAGAAGTGAGGAAGAGGG - Intronic
1177447575 21:21217770-21217792 CAGAGGTGAGTTGATGCAGAAGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1179382339 21:40911122-40911144 GATATGGGAGATGTGGCAGATGG - Intergenic
1180260716 21:46667205-46667227 CAGGTGAGCAATGATGCAGAGGG + Intergenic
1181348954 22:22241751-22241773 CGGATGTGAAATGAGGGAGACGG + Intergenic
1181436285 22:22913101-22913123 CAGATGAGAAGGAAGGCAGATGG + Intergenic
1181658675 22:24323236-24323258 CAGATTCGAGATGAGGCGGGGGG - Intronic
1181660002 22:24339468-24339490 CAGATGAGAAGCGGGGCAGAGGG + Intronic
1182093824 22:27613289-27613311 CAGATGAGCCCTGGGGCAGAGGG + Intergenic
1183028353 22:35083402-35083424 CAGATGAGAGATTAGCCTGTTGG - Intronic
1183363296 22:37394175-37394197 GAAATGAGAGACGAGGGAGAGGG - Intronic
1184189359 22:42884747-42884769 CAGCTGAGAGACAGGGCAGATGG - Intronic
1184390769 22:44201891-44201913 CACATGAGAGACCAGGCAGAAGG + Intronic
1184957815 22:47903525-47903547 CAGTTTAGAGTTGAGGCAAAAGG + Intergenic
1185270430 22:49927065-49927087 CAGATGAGAGATGAGGCAGACGG - Intronic
949091063 3:29686-29708 AAGAGCAGAGAAGAGGCAGATGG + Intergenic
949569055 3:5274118-5274140 GAGAGGAGAGATGAGGCAGAAGG + Intergenic
950260987 3:11543410-11543432 CAGCTGAGGGCTGAGGCAGGGGG - Intronic
950404609 3:12796887-12796909 GAGAAGAGAGAAGAGGCAGGGGG - Intronic
950872964 3:16245225-16245247 AGGATGTGAGATGGGGCAGAAGG - Intergenic
950905986 3:16538733-16538755 CAGCAGGGAGATGAGGCAGAAGG + Intergenic
950962921 3:17124036-17124058 AAGAGGAAAGATGAGGAAGAAGG + Intergenic
951681026 3:25294792-25294814 AAGAAGAGAGAGGAGGAAGAGGG + Intronic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
951940252 3:28069794-28069816 CAGATGAGAAAACAGGCAGAGGG - Intergenic
952334175 3:32391038-32391060 CAGAAAAGAGATGAGGGAGGGGG + Intergenic
952681515 3:36098958-36098980 CAGATGTGTGATGAGGGACATGG + Intergenic
952926891 3:38326747-38326769 CAGATAAGGCATGAGGCTGAGGG - Intergenic
954443397 3:50533978-50534000 CTGATGAGAGAGGAGGCCCAGGG - Intergenic
955015547 3:55065671-55065693 AAGAAGAGAGAGGAGGGAGAGGG + Intronic
956946833 3:74232837-74232859 AAGATGAGGGATGAGATAGAGGG + Intergenic
957502443 3:81074739-81074761 CAGATGAGAGATGTGGTAGTGGG - Intergenic
958017568 3:87958921-87958943 AAGTTCAGAGATGAGGAAGATGG - Intergenic
958480503 3:94640246-94640268 CACAAGATAGATGAGACAGAAGG - Intergenic
959749094 3:109812066-109812088 CAGAAGGGACATGAGACAGATGG + Intergenic
959943509 3:112104164-112104186 CAGTTGAGTGATTGGGCAGATGG + Intronic
960470545 3:118059615-118059637 CAGAGAAGATATGAGGTAGAGGG - Intergenic
962802057 3:138898813-138898835 AAGATGAGAGGTGAGGGACAAGG - Intergenic
962883889 3:139605153-139605175 CAGATCAGCGATGAGTCTGAGGG + Intronic
962906971 3:139812738-139812760 AAGGTGAGAGCTGAGGCAGATGG + Intergenic
964206686 3:154182718-154182740 CCGCTGAGAGCTGAGGCAGCAGG + Intronic
964227061 3:154416776-154416798 CAAATGAGAGACAAAGCAGAGGG - Intronic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
965079667 3:164020481-164020503 GAGATGATGGATGAGGGAGAGGG + Intergenic
965089262 3:164142394-164142416 GAGCTGAGAGATCAGCCAGAAGG - Intergenic
965547854 3:169933935-169933957 AAGAGGAGAGGTGAGGCAGGAGG + Intronic
965630887 3:170731381-170731403 CAAATGAGAGATGATGCTGCAGG - Intronic
966014582 3:175125867-175125889 GAGAAGAGAGATGAGACATAAGG + Intronic
966552643 3:181222322-181222344 CAAATGTGAGATGAGGAAGAAGG + Intergenic
968094235 3:195916743-195916765 GAGTCGAGAGAGGAGGCAGAAGG - Intergenic
968964342 4:3761930-3761952 CCCAGGAAAGATGAGGCAGAGGG + Intergenic
969347240 4:6577050-6577072 CAAATGAGAGAAGAGGGTGAGGG - Intronic
970000031 4:11355765-11355787 CAGCTTAGAGAGGAAGCAGATGG + Intergenic
970143135 4:13004642-13004664 CAGTGTAGAGATGAGGCACAGGG - Intergenic
970213148 4:13731665-13731687 GAGATAAGAGAAGAGGCAGGGGG + Intergenic
970334368 4:15019542-15019564 GAGACAAGAGATGAGACAGAGGG - Intronic
970403615 4:15741391-15741413 AAGAGGAAAGCTGAGGCAGATGG + Intergenic
971580653 4:28335120-28335142 CAGGTGAGAGAGAAGGCCGAAGG - Intergenic
972596967 4:40538157-40538179 TTGATCAGAGATCAGGCAGAAGG + Intronic
972654338 4:41050386-41050408 CAGATGAGAGATTAGGGAACTGG + Intronic
972654998 4:41055626-41055648 TAGATGAGAGAGGAGTCAGAGGG - Intronic
973296692 4:48530587-48530609 GTGATGAGACATGAGGCTGAAGG - Intronic
973570204 4:52231111-52231133 CAGAAAAGAGAAGAGGAAGAAGG + Intergenic
973798799 4:54455759-54455781 CAGATGAGAGGTGGCTCAGAGGG + Intergenic
974205007 4:58690357-58690379 CAGAAGAGAAATGAGGAAAATGG - Intergenic
974222688 4:58996922-58996944 GAGATGAGAGAAGAGGCTGTTGG + Intergenic
974604228 4:64129428-64129450 CTGCTGAGGGATGAGGCAGAGGG - Intergenic
974781892 4:66562730-66562752 CAGAAGAGAGATGAGGGTAAGGG - Intergenic
974856143 4:67463894-67463916 AAGATCAGAGGTGAGGGAGATGG + Intergenic
975675508 4:76823641-76823663 CAGATGAGAGGGCAGACAGAGGG + Intergenic
975875810 4:78835683-78835705 GAGAAGAGGGATGAGGCAGGAGG - Intronic
978367217 4:107995045-107995067 CAGATAAGAGAGAAGGGAGAGGG - Intronic
978829466 4:113067007-113067029 CAGGTGAGAAATGAGGCTGGAGG + Intronic
980346726 4:131632175-131632197 CAGGAGAGAGATGAAGCAAAGGG - Intergenic
981622103 4:146712972-146712994 CAGATGAGAGGTTAGGAAGGTGG - Intronic
981844500 4:149152177-149152199 CAGATGAGAGGGGAGACAGATGG + Intergenic
982328808 4:154158490-154158512 GAGATGAGACATCAGGCAGATGG - Intergenic
982821394 4:159944438-159944460 GAGAAGGGAGAGGAGGCAGAAGG - Intergenic
983478731 4:168246980-168247002 GGGATGAGAGATGGGGAAGATGG - Intronic
983634234 4:169881720-169881742 AAGATGAGAGAAGAAACAGAGGG + Intergenic
983676771 4:170303741-170303763 AAGTTGAGAGATGAGTCTGATGG + Intergenic
984809484 4:183782205-183782227 CAGAAGAGAGATGTGGCAGGAGG - Intergenic
984930297 4:184841358-184841380 GAGATGAGTGGTCAGGCAGAAGG + Intergenic
984993866 4:185408892-185408914 GAGATGACAGGTGAGGCAGGGGG - Intronic
985583977 5:717721-717743 CAAATGGGAGCTGATGCAGAAGG + Intronic
985597481 5:802021-802043 CAAATGGGAGCTGATGCAGAAGG + Intronic
985843135 5:2324584-2324606 CACATGGGACATGAGGCAGAGGG + Intergenic
985998041 5:3607880-3607902 GAGATTAGAAAGGAGGCAGAAGG - Intergenic
987356800 5:17070424-17070446 CAGATGAGGGATGAGGCCAGAGG + Intronic
987883740 5:23784458-23784480 AAAAAGAGAGATGTGGCAGAAGG + Intergenic
988399633 5:30746106-30746128 CAAAACAGAGAGGAGGCAGATGG - Intergenic
988722515 5:33892382-33892404 GAGAACAGAGTTGAGGCAGAGGG + Intergenic
988993186 5:36690777-36690799 GAGAAGGGAGATGAGGCACAAGG - Intergenic
990317953 5:54601801-54601823 CAGGTGAGAAATGAGGAAGAAGG - Intergenic
990512354 5:56500134-56500156 CAGTTGAGACATGAGGAAGCTGG - Intergenic
990722122 5:58708351-58708373 CAAATGTGAGAGCAGGCAGATGG - Intronic
992952274 5:81871841-81871863 CAGAGGAGATATGAGGCAACTGG - Intergenic
993730664 5:91418394-91418416 CAGATGAGTGAGGAAGCACAAGG - Intergenic
993839468 5:92859239-92859261 GAGTTGAGAAATTAGGCAGAAGG - Intergenic
994246578 5:97485510-97485532 GAGGTGAGAGAAAAGGCAGATGG + Intergenic
995869450 5:116729168-116729190 CTGTTGAGAGCTGAGACAGAGGG - Intergenic
996341721 5:122445828-122445850 AAGCTTAGAGAAGAGGCAGAGGG - Intronic
997468598 5:134104224-134104246 CAGATGAGGGATGAGGGGAAGGG - Intergenic
997665624 5:135627630-135627652 AGGAGGAGAGATGAGGAAGAGGG - Intergenic
997728767 5:136147620-136147642 CAGATGAGAAAACAGGCAAAGGG - Intronic
998499719 5:142621744-142621766 GTGATGGGAAATGAGGCAGAGGG - Intronic
998892309 5:146759325-146759347 CAGATAAAAGGTGAGGTAGAGGG - Intronic
999096098 5:148979349-148979371 TAGATGACAGATGAGGCATTAGG + Intronic
999696442 5:154191492-154191514 CAGATGAGAAATCAGGAAAAGGG - Intronic
1000010110 5:157223125-157223147 GAGAAGAGAGCAGAGGCAGAAGG + Intronic
1000881182 5:166699454-166699476 AAGATGAAAAATGAGGCATAGGG - Intergenic
1001228379 5:169964642-169964664 CTGCTGGGAGATGAGGCAGAAGG - Intronic
1001368971 5:171176893-171176915 AGGATGAGAGATGAAGCAAAGGG + Intronic
1001634465 5:173199752-173199774 CAGGTGGGAGATGAGGCTGGAGG + Intergenic
1002169304 5:177366475-177366497 CAGCTGGGAGAAGAGGAAGAGGG - Intronic
1002203507 5:177546460-177546482 CAGCTGAGACATGAGCCAGATGG - Intronic
1003393923 6:5736897-5736919 CAGAAGAGAGATGAGTGAGATGG - Intronic
1004017981 6:11749676-11749698 CTGCTGAGAGGTGAGGAAGATGG + Intronic
1004086181 6:12451777-12451799 CAGATAGGAGATGATGCTGATGG + Intergenic
1004742151 6:18472475-18472497 CAGATGGGAGATGAGACTCAGGG + Intergenic
1005267264 6:24125536-24125558 AAAATGAGTGAAGAGGCAGATGG - Intergenic
1005956833 6:30670085-30670107 CTAATGAGATATGAGGCAGCTGG - Intronic
1005983693 6:30856775-30856797 TATAGAAGAGATGAGGCAGATGG - Intergenic
1006887422 6:37394322-37394344 CAAATGGGAGTTGAGGCAGTAGG + Exonic
1007177161 6:39904755-39904777 CAGATGACAAATGAGGCTAATGG + Exonic
1007409291 6:41652549-41652571 CAGGTGAGAGATGAGCCAGGTGG + Intronic
1007743711 6:44029396-44029418 AAGATGGGAGATACGGCAGAAGG - Intergenic
1007743717 6:44029421-44029443 CAAAGGAGAGATGTGGCAAAAGG - Intergenic
1009323429 6:62319370-62319392 AAGAAGAAAGAAGAGGCAGATGG + Intergenic
1009927492 6:70137648-70137670 CAGAAGAGAGATTTTGCAGATGG - Intronic
1010030872 6:71269409-71269431 CACAGGAGAGATGAAGGAGAAGG + Intergenic
1010040016 6:71370308-71370330 AAAATGAGAAATGAGGCAGGTGG - Intergenic
1010073420 6:71771477-71771499 CAGAGGAGAGATGAGTGACATGG - Intergenic
1010355000 6:74922409-74922431 CAAAAGAGGAATGAGGCAGAAGG - Intergenic
1011325250 6:86143381-86143403 TACCTGAGAGATGAGGCAAAGGG - Intergenic
1011535421 6:88371211-88371233 CAGATGAGTGATGTGACAGGAGG - Intergenic
1011546168 6:88483659-88483681 CACAGGAGAGATGAGGAAAATGG - Intergenic
1013823064 6:114178774-114178796 AAGGGGAGAGATGAGGGAGAAGG + Intronic
1014051869 6:116964264-116964286 CAGAAAAGACATGAGGCAGAAGG - Intergenic
1014101050 6:117512275-117512297 CAGATGATAAATGAAGCAGGCGG - Intronic
1014255920 6:119159938-119159960 CATATGAGAGAGGGGACAGAAGG - Intergenic
1014981273 6:127948990-127949012 CAGCTGACACAGGAGGCAGAGGG + Intergenic
1015127384 6:129769798-129769820 CAGATGGTAAATGAGGTAGATGG - Intergenic
1015427427 6:133088123-133088145 GACAGGACAGATGAGGCAGAAGG + Intergenic
1015594758 6:134855877-134855899 CAGATGAGATTTGGGGCAGTGGG + Intergenic
1016277320 6:142370019-142370041 CAGAGGATAGATGAGTAAGAGGG + Intronic
1017839157 6:158207515-158207537 CAGATGCTACATGAGACAGATGG + Intergenic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1018643038 6:165922399-165922421 CAGCTGAGGTATGCGGCAGATGG + Intronic
1018782246 6:167078686-167078708 CAGGTGAGACATGAGGCTGCTGG - Intergenic
1019944879 7:4319501-4319523 CAGATATGAGATGAGGGAGCCGG - Intergenic
1020286289 7:6683666-6683688 CAGCTGAGACTTGAGGAAGAGGG + Intergenic
1020381775 7:7555566-7555588 AAGAAGGGAGATTAGGCAGAGGG - Intergenic
1020471266 7:8537748-8537770 CATCTGAAAGATGAGGCAGTTGG + Intronic
1020628064 7:10607480-10607502 CAGAGGAGAGATGAGGCAGAAGG - Intergenic
1020756553 7:12210964-12210986 CAGCTGAAAGCTGAGGCAGATGG + Intergenic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023828624 7:44026334-44026356 GAGATGAGACAAGAGGTAGAGGG - Intergenic
1027153616 7:75750792-75750814 GAGATGACAGATGAAGCAGTGGG + Intergenic
1027630458 7:80597951-80597973 AAAATAAGAGATGATGCAGAAGG - Intronic
1027679365 7:81200548-81200570 CAGATTATATCTGAGGCAGAAGG + Intergenic
1028361997 7:89979133-89979155 CACATGAAAGATGAGGAGGATGG + Intergenic
1028471307 7:91209489-91209511 CAGAAGAGAAAAGAAGCAGAGGG - Exonic
1028887716 7:95952780-95952802 CAGAGGAAGGACGAGGCAGAGGG - Intronic
1029738919 7:102480614-102480636 GAGATGAGACAAGAGGTAGAGGG - Intergenic
1029756920 7:102579777-102579799 GAGATGAGACAAGAGGTAGAGGG - Exonic
1029774859 7:102678837-102678859 GAGATGAGACAAGAGGTAGAGGG - Intergenic
1030269647 7:107656516-107656538 CATATTAAAGAAGAGGCAGATGG + Intergenic
1030472192 7:109978918-109978940 CAGAGGAGAGTTGAAGCACAAGG + Intergenic
1030541060 7:110831222-110831244 CAGAAGAAAGATGAGGTAGAAGG - Intronic
1033387638 7:140893857-140893879 GAAATGGGAGATGAGGCAGGAGG + Intronic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1035353169 7:158260926-158260948 GGGAGGAGAGAGGAGGCAGACGG + Intronic
1035640574 8:1181966-1181988 CAGCAGATAGTTGAGGCAGAAGG + Intergenic
1036064282 8:5360731-5360753 CATATGAGAAATGCGGAAGACGG + Intergenic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036283012 8:7417469-7417491 CGGGAGAGAGATGAGGCAGATGG + Intergenic
1036338457 8:7894050-7894072 CGGGAGAGAGATGAGGCAGATGG - Intergenic
1036493836 8:9251728-9251750 AAGGTGAGAGATGATGCAGTGGG - Intergenic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1037432425 8:18827789-18827811 TATATGAGAGATGAAGAAGAGGG + Intronic
1037703419 8:21295656-21295678 CAGAGGAGAGATGAGAGAAAGGG - Intergenic
1037916662 8:22777264-22777286 AATGTGAGAGATGATGCAGATGG - Intronic
1038244885 8:25846326-25846348 CAGCTGATAAATGAGGTAGAAGG + Intronic
1038869799 8:31481575-31481597 CGGAGGAGGCATGAGGCAGAAGG + Intergenic
1039496316 8:37983278-37983300 ATGATGAGAGCAGAGGCAGAAGG - Intergenic
1041165222 8:55085419-55085441 CAAAGGACAGATGAGGTAGAGGG - Intergenic
1041625074 8:60016087-60016109 CAGATGCCAGATGAGGCTGGGGG + Intergenic
1042239481 8:66648466-66648488 TAGATGACAGATTAGGTAGATGG - Intronic
1042539238 8:69891251-69891273 CAGATTAGAGGTGAGGGAGTTGG - Intergenic
1042736349 8:71993599-71993621 CAGATGACAGATGACACACAAGG + Intronic
1043093471 8:75934250-75934272 CAGAGATGAGATGAGGCAGAAGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1045052180 8:98337372-98337394 CAGATCAGAGATCAGGAAAATGG - Intergenic
1045295656 8:100869950-100869972 CAGATCAGAGCTGAGGGAGGCGG - Intergenic
1045385310 8:101666791-101666813 CAGTTGTGAGATGGGGGAGATGG - Exonic
1045503048 8:102757955-102757977 CAGGTAAGAGAGGAGGGAGAGGG + Intergenic
1045540159 8:103076480-103076502 CACATAAGATATGAGGCAGTAGG - Intergenic
1046220639 8:111209502-111209524 TAGATGACAGATAAGACAGATGG - Intergenic
1046299542 8:112269222-112269244 CAGAGGACAGATCAGGAAGATGG - Intronic
1046721062 8:117619688-117619710 CAACTGAGAGATGGGGAAGATGG - Intergenic
1048251952 8:132873868-132873890 CAGAAGAAAGAGTAGGCAGAAGG + Intronic
1048261379 8:132948349-132948371 ATGATGGGAAATGAGGCAGAAGG + Intronic
1048307579 8:133294986-133295008 CAGATGGAAAATGAGGCACAGGG - Intronic
1048759904 8:137782544-137782566 CCCATGAGAGATGTGGTAGAGGG - Intergenic
1048875974 8:138837411-138837433 CAGGGGAGAGATGAGGGACAGGG - Intronic
1049258580 8:141626805-141626827 AAGGTGAGAGAAGGGGCAGAGGG - Intergenic
1049288423 8:141789030-141789052 AAGATGAAAGAAGAGACAGAAGG - Intergenic
1050051796 9:1609990-1610012 CAGAGGAGATTTTAGGCAGAAGG - Intergenic
1050927040 9:11276627-11276649 GAGATGAGAGATGATGATGAGGG - Intergenic
1051105306 9:13572471-13572493 AATATGAGAAATGAGGGAGAGGG - Intergenic
1051348760 9:16178664-16178686 AAGATAAGAGATGTGGAAGATGG - Intergenic
1051887164 9:21905259-21905281 CAGATGGGTGGTGAGCCAGAAGG + Intronic
1052347409 9:27424470-27424492 CAGATGAGAAATGAAGTAAATGG - Intronic
1053158875 9:35799929-35799951 CAGAAGAGAGAATAGGTAGAAGG + Intronic
1053390580 9:37732568-37732590 CAGATTAGAGAGGGTGCAGAGGG - Intronic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1055400509 9:75919118-75919140 GAGGTGAGAGGTGAGGCAAAAGG - Intronic
1056028269 9:82524142-82524164 AACATGAAAGAGGAGGCAGAGGG - Intergenic
1056236095 9:84596201-84596223 GAGAGGAGAGAGGAGGAAGATGG - Intergenic
1056630697 9:88290787-88290809 GAGATGGGAGATGAGACAAAGGG - Intergenic
1057294813 9:93828680-93828702 CAGGTCAGGGAGGAGGCAGAGGG - Intergenic
1057424658 9:94938515-94938537 GAGATGGGTGAAGAGGCAGAGGG + Intronic
1057829359 9:98395202-98395224 CAAATGGGAGATGAAGAAGAGGG + Intronic
1057839905 9:98477914-98477936 CATTTCAGAGATGAGGCAGCTGG + Intronic
1057926400 9:99154714-99154736 CAGTGGAGAGATGAGGCAGAAGG - Intergenic
1058300281 9:103362997-103363019 AATAGGAGAGATGGGGCAGAAGG + Intergenic
1059249120 9:112872447-112872469 CTGGTGAGAGAGGAGGAAGAGGG + Exonic
1059834926 9:118141122-118141144 CAGATGAAGAATGAGGTAGATGG + Intergenic
1060787604 9:126463055-126463077 CAGTGGGGAGATGAGGCGGAAGG - Intronic
1061281692 9:129601367-129601389 GAGAGGAGGGAGGAGGCAGAGGG + Intergenic
1061772033 9:132932664-132932686 CAGAGGAATGAAGAGGCAGAGGG - Intronic
1061836296 9:133332285-133332307 CAGAAAAGAGAAGAGGCAGAGGG - Exonic
1062321877 9:135994203-135994225 CACATCAGGGAGGAGGCAGAGGG - Intergenic
1185498220 X:575236-575258 CAGATGAGAGCAGAGCAAGAAGG - Intergenic
1186635861 X:11404153-11404175 CATCAGAGAGATGAGGAAGACGG - Intronic
1188244782 X:27826335-27826357 CAGAAGAGAGATGCAGCAGACGG - Intergenic
1188379415 X:29472860-29472882 GAGATGGGAGATGAGGCAGAGGG - Intronic
1188798720 X:34499825-34499847 GACATGGGAGAAGAGGCAGAAGG + Intergenic
1189513836 X:41691150-41691172 CAGATTAGAGCTGAGGCAAATGG + Intronic
1190737069 X:53262600-53262622 CAGGGGAGAGAGGAGGCAGGGGG + Intronic
1190743396 X:53305808-53305830 CAGGAGACAGATGAGGGAGAGGG - Intronic
1192756789 X:74055098-74055120 CAGATCAGAGAAGAGCCACAAGG + Intergenic
1194984765 X:100478435-100478457 AGGAACAGAGATGAGGCAGAGGG - Intergenic
1195109347 X:101629984-101630006 TAGATGGGAGAGGAGGGAGAGGG + Intergenic
1195642526 X:107192313-107192335 CAGCTGAGATTTGAGGCACAAGG - Intronic
1195725867 X:107915704-107915726 CAGATGGAAAATGATGCAGAGGG + Intronic
1198856869 X:141027153-141027175 CAGATGTGAGATGGAACAGAGGG + Intergenic
1198905825 X:141560214-141560236 CAGATGTGAGATGGAACAGAGGG - Intergenic
1199265125 X:145819737-145819759 GAGATGAGCTCTGAGGCAGAGGG - Exonic
1199338309 X:146645158-146645180 CATATGATACAAGAGGCAGATGG + Intergenic
1199744165 X:150761480-150761502 CTGGTGAAAGATGAGCCAGAGGG + Intronic
1199840864 X:151646954-151646976 CAGAAGAGAGTTGAGAAAGAGGG + Intronic
1199910725 X:152284018-152284040 CAGTGGAGAGTTGAAGCAGAAGG - Intronic
1200410023 Y:2851754-2851776 CTTACGTGAGATGAGGCAGAGGG - Intronic
1201651037 Y:16287141-16287163 TAGATGATAGATAAGGTAGATGG - Intergenic
1201747118 Y:17388919-17388941 TAGATGATAGATTAGACAGATGG + Intergenic