ID: 1185270431

View in Genome Browser
Species Human (GRCh38)
Location 22:49927072-49927094
Sequence CACAAAGCAGATGAGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 438}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270431_1185270444 22 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 70
1185270431_1185270442 21 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270442 22:49927116-49927138 GCCCTTGGATGGCTGCGTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 132
1185270431_1185270439 10 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270439 22:49927105-49927127 GTCTCCGAGCTGCCCTTGGATGG 0: 1
1: 0
2: 0
3: 10
4: 124
1185270431_1185270441 20 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270441 22:49927115-49927137 TGCCCTTGGATGGCTGCGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
1185270431_1185270438 6 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270438 22:49927101-49927123 GGGGGTCTCCGAGCTGCCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270431 Original CRISPR CACAAAGCAGATGAGAGATG AGG (reversed) Intronic
902790211 1:18762647-18762669 CAGACAGCTGATGAGAGAAGGGG + Intergenic
902817889 1:18926484-18926506 CACAAAGCAGCTGAGATCAGGGG + Intronic
902871817 1:19318221-19318243 CACACAGCTGGTCAGAGATGGGG + Intronic
903063637 1:20686273-20686295 CACAAAGGAGGGAAGAGATGAGG + Intronic
904098087 1:27997735-27997757 TGCAAAGGAGATGTGAGATGTGG - Intronic
904563763 1:31414892-31414914 CACAATGCTGTTGGGAGATGAGG + Intronic
905295598 1:36952457-36952479 CACAAAACTAATGAGAGAGGTGG - Intronic
905790480 1:40786628-40786650 CACAGAGCACATAAGAGGTGGGG - Intronic
908025395 1:59945954-59945976 CATAATGGAGATGAGAGATAAGG - Intergenic
908140525 1:61179717-61179739 CAGAAACCAGATGAGAGAAAGGG - Intronic
908654995 1:66379158-66379180 CACAAAGCAGACCAGAAATCTGG - Intergenic
908869996 1:68599244-68599266 AACTAAACAGTTGAGAGATGTGG - Intergenic
909471728 1:76036661-76036683 CACAAAGCAGGTGGGAGCTGGGG - Intergenic
909929549 1:81480043-81480065 CACATAGCTGATGATAGAAGAGG + Intronic
910087063 1:83416034-83416056 AATAATGCAGATGAGAGATGAGG + Intergenic
910099248 1:83559092-83559114 CACAGAGCACATCAGAGATATGG - Intergenic
910713175 1:90202898-90202920 CACACAGCAGAAGAATGATGGGG + Intergenic
911540665 1:99154205-99154227 AAAAGAGCAGATGAGAGTTGAGG + Intergenic
911664192 1:100535522-100535544 CAGAAAGCAGATGACTGATGGGG + Intergenic
912379494 1:109239718-109239740 CACAAAGCAGCTGAGAGTCCAGG - Intergenic
912499214 1:110110821-110110843 CACAGAGCTGGTGAGAGTTGAGG + Intergenic
913061496 1:115212426-115212448 CAAAATGCAGATCAGAGAGGGGG + Intergenic
913312329 1:117513121-117513143 CAGAAAGCAGATTAGAGTTTGGG - Intronic
913683587 1:121210541-121210563 CAGTAAGCAGATGAGAGGTAGGG + Intronic
914035428 1:143998166-143998188 CAGTAAGCAGATGAGAGGTAGGG + Intergenic
914154023 1:145069803-145069825 CAGTAAGCAGATGAGAGGTAGGG - Intronic
914810896 1:151027209-151027231 TAGAAAGCAGATGAGAGACTAGG - Intronic
915093100 1:153440048-153440070 CAAAAAACAGATGGGAGAGGTGG - Intergenic
915773739 1:158459452-158459474 CACTTATCAGATGATAGATGTGG - Intergenic
916591879 1:166199297-166199319 GACAAAGCAGAAGAGAGACTAGG + Intergenic
917440777 1:175067088-175067110 CACAGAGCAGGAGAGGGATGGGG + Intergenic
917596605 1:176535514-176535536 CTAAAGGCACATGAGAGATGTGG + Intronic
918289901 1:183097262-183097284 CACAAAGTCAATTAGAGATGGGG - Intronic
920036016 1:203066046-203066068 CACCCAGCAAATGTGAGATGGGG - Intronic
920470893 1:206229052-206229074 CAGTAAGCAGATGAGAGGTAGGG + Intronic
920592732 1:207236940-207236962 GACAAAGAAGATAAGAAATGGGG - Intergenic
920711530 1:208300037-208300059 CACACAGCAGATTAGTAATGTGG - Intergenic
921365680 1:214371430-214371452 CACAAAGAGGAGGAGGGATGAGG + Intronic
921811075 1:219515298-219515320 CACAAAACAGACCAGATATGAGG + Intergenic
922053868 1:222021705-222021727 CAGAAAGCAGAGGAGAGCTGAGG - Intergenic
922098471 1:222462369-222462391 CACAAAACAGCTGAGGGATGTGG + Intergenic
923912356 1:238462853-238462875 CAAATTGCAGATGAGAGATATGG + Intergenic
924408517 1:243777733-243777755 TCCAAAAAAGATGAGAGATGGGG - Intronic
924577181 1:245291464-245291486 CACAAAGCAGTGGAGGGATCAGG - Intronic
924927671 1:248699003-248699025 AACAAAGAAGATGGGAGATGGGG - Intergenic
1062867482 10:868204-868226 CAGAAAGCAGGTGAGAAATAGGG + Intronic
1063594037 10:7416822-7416844 CACAGTGCAGGTCAGAGATGTGG + Intergenic
1063644598 10:7866314-7866336 AAATAAGAAGATGAGAGATGAGG + Intronic
1064227098 10:13496400-13496422 CACTAAGCAGATAAGAAATGTGG - Intronic
1066019548 10:31284171-31284193 CACAAAGCAGAGGCTAGAAGAGG + Intergenic
1067118594 10:43455411-43455433 AGCAAAGCAGCTGAGTGATGTGG - Intronic
1067695152 10:48529225-48529247 CATAAGCCAGGTGAGAGATGTGG + Intronic
1068831089 10:61495751-61495773 CAGAGAACAGAGGAGAGATGAGG + Intergenic
1070324020 10:75375999-75376021 CACAAGGCAGATCAGAAGTGAGG + Intergenic
1070380287 10:75875209-75875231 CAGGAAGCAGTTCAGAGATGAGG - Intronic
1070743457 10:78917869-78917891 AACTAAGCAGATGAGGAATGGGG - Intergenic
1070780096 10:79132672-79132694 CACAAAGCAGTGGTGAGCTGGGG + Intronic
1070834397 10:79438781-79438803 GACAAAGCAGAGGAGACCTGGGG + Intronic
1070949032 10:80416105-80416127 CAGCAAGCAGATAAGAGCTGTGG + Intronic
1071321753 10:84466968-84466990 CTCAAGACAGATGAGAGAGGAGG - Intronic
1071333569 10:84584289-84584311 CTCACAGAAGATGAGAGAAGAGG + Intergenic
1072302393 10:94073828-94073850 AACCAAGGAGATGGGAGATGAGG + Intronic
1072537418 10:96374053-96374075 CACACTGCAGATGAGAGAGCAGG + Intronic
1072743262 10:97922951-97922973 CCCAAAGCAGATGAGTGGTGTGG - Intronic
1072923380 10:99595547-99595569 ATCAAAGCAGTTGGGAGATGTGG - Intergenic
1073579580 10:104652345-104652367 CACAAAGTAGATGTGATATTAGG + Intronic
1075024723 10:118976073-118976095 CTCAAAGCTGAGGAGATATGAGG + Intergenic
1075078439 10:119367289-119367311 CACACTCCAGATGAGAGATGGGG - Intronic
1075182845 10:120227554-120227576 CACAAAGAAGAGGGGAAATGAGG - Intergenic
1076165859 10:128281937-128281959 CACAAAGCAGATTAGAAACTGGG - Intergenic
1076467313 10:130692410-130692432 GACAGAGCTGATCAGAGATGAGG - Intergenic
1077659414 11:4054190-4054212 CACACAGTAGATGTGAGAGGAGG + Intronic
1077801597 11:5544593-5544615 GACCAAGCAGATCAGAGATAAGG - Exonic
1079267249 11:18945062-18945084 CACAAGGCAGAAGAGAGTGGGGG + Intergenic
1080149625 11:29035701-29035723 CTTAAAGCAAATGAAAGATGAGG + Intergenic
1080638609 11:34144991-34145013 CACAAAGCATCTGGGAAATGAGG - Intronic
1081595763 11:44458291-44458313 CACAAAGAAGCTGAGGGAAGAGG + Intergenic
1083173358 11:60935434-60935456 CCCAAAGCAGGTGACAGTTGGGG + Exonic
1083773112 11:64879144-64879166 CCCAAAGCAGATAAAAGATGAGG - Intronic
1084605246 11:70168417-70168439 CACCAAGCAGAGGAGGGGTGGGG - Intronic
1084623201 11:70288053-70288075 AAAAAAGCAGAGGTGAGATGAGG - Intronic
1084708454 11:70829524-70829546 CCCAAACCAGATGGGACATGGGG - Intronic
1085133898 11:74067292-74067314 CACAAAGCAGGAGAGAACTGAGG + Intronic
1085204145 11:74720452-74720474 GCCACAGGAGATGAGAGATGAGG - Intronic
1085318242 11:75558968-75558990 CACACAGCATATCAGAGGTGGGG - Intergenic
1085851879 11:80130219-80130241 CATACAGCAGATGAGTGGTGTGG - Intergenic
1085901243 11:80702364-80702386 CACAAACTAGGAGAGAGATGGGG - Intergenic
1086294924 11:85354577-85354599 TCCAAATCAGATGATAGATGTGG - Intronic
1086600881 11:88631832-88631854 CACAAAAGATATGAGAGATAAGG + Intronic
1087931050 11:103978006-103978028 CACACAGCACAGGAGAGATTAGG + Intronic
1088878573 11:113956145-113956167 CACAAACCAAATGAGTGGTGGGG - Intergenic
1089056825 11:115592318-115592340 CACACAGCTGATGAGGGCTGGGG - Intergenic
1089094008 11:115903074-115903096 GAGAAAGCAGATGAGTGAAGAGG + Intergenic
1089116371 11:116098404-116098426 CACACAGGAGATGAGGGAAGTGG + Intergenic
1089342912 11:117771671-117771693 CACACAGCTAATAAGAGATGTGG - Intronic
1090540099 11:127692432-127692454 TACAAAGCAGATCTGGGATGAGG - Intergenic
1090558857 11:127907135-127907157 CTCAAGGTAGATGAGAGGTGGGG - Intergenic
1091540096 12:1452534-1452556 TACAAAGGAGAAGAGAGAAGTGG - Intronic
1092026004 12:5241080-5241102 CACAAAGTAGTGGGGAGATGGGG + Intergenic
1092278603 12:7081842-7081864 CACTAAGCAGATGGGAAATCAGG - Intronic
1093055530 12:14552538-14552560 TAGAAAGCAAATGAGAGGTGGGG - Intronic
1093128186 12:15355533-15355555 CACACACAAGATGAGACATGTGG + Intronic
1094552512 12:31466007-31466029 CATAAAGCAGGAGACAGATGTGG + Intronic
1096081672 12:48837410-48837432 CACAAAGCACATGAGCTTTGAGG + Intronic
1096390565 12:51225494-51225516 AACAAAGCAGATGTCAGTTGCGG + Intergenic
1097512027 12:60555523-60555545 CACAAAACAGATAAGAGAATGGG - Intergenic
1098138210 12:67425308-67425330 CACATAGATGATGAGAAATGTGG - Intergenic
1099169479 12:79346765-79346787 TACAAAGCAGATGACTGGTGAGG + Intronic
1099717410 12:86313312-86313334 CACAATGCAGGTAAGAGATATGG + Intronic
1099838104 12:87933192-87933214 AATAGAGCAGATGGGAGATGTGG + Intergenic
1100222370 12:92519327-92519349 CTCAAAGGAGATGATACATGAGG + Intergenic
1100744438 12:97630043-97630065 TGCAAAGCTGCTGAGAGATGTGG - Intergenic
1101282128 12:103269297-103269319 CATAAAGCAGAGGTGAAATGTGG + Intronic
1102641136 12:114367602-114367624 CTCAAAGGAAATGAGAGAGGTGG + Intronic
1104061205 12:125270094-125270116 CACAACAAAGATGTGAGATGTGG - Intronic
1104081694 12:125435288-125435310 AAGAAGGCAGATGAGAGCTGTGG + Intronic
1105458141 13:20559961-20559983 AACAAGGCAGGTGAGAGAAGAGG + Intergenic
1105825419 13:24118479-24118501 TACAAAGCACATGTCAGATGTGG + Intronic
1105965497 13:25380200-25380222 AACCAGGGAGATGAGAGATGAGG + Intronic
1106091575 13:26600024-26600046 CCCAAAGAGGATGACAGATGTGG - Intronic
1106183544 13:27388220-27388242 ACCAAAGCAGATGACAGAGGAGG - Intergenic
1107271169 13:38618616-38618638 CAAAAATAAGATGAGATATGGGG - Intergenic
1107501778 13:40986168-40986190 CACAAAGCAGTTCAGAGAACAGG + Intronic
1107999537 13:45893701-45893723 CACACTGCAGATGAGACCTGGGG - Intergenic
1108760829 13:53562252-53562274 GACAAAGAGGAGGAGAGATGGGG - Intergenic
1108818645 13:54319394-54319416 CATTAAGCTGATGAGAGATATGG + Intergenic
1109485658 13:63016132-63016154 CAGAAATCATATGAGAGAGGAGG + Intergenic
1110466967 13:75813404-75813426 CACTTAGCAGGTGAGAAATGGGG + Intronic
1110483741 13:76014277-76014299 CACAAAACAGATTAGATGTGGGG - Intergenic
1110737290 13:78952023-78952045 CAGAAAGCAGAAGAGAGAAGAGG - Intergenic
1110801573 13:79702986-79703008 CACAAATCATAGGAGTGATGAGG + Intergenic
1110818713 13:79888869-79888891 CACAAGCCAGAAGAGAGTTGGGG + Intergenic
1113651286 13:112035660-112035682 TATGAAGGAGATGAGAGATGGGG - Intergenic
1117278303 14:54212111-54212133 CACAAAGCAAATGAGTAATTTGG + Intergenic
1117729629 14:58709324-58709346 CACACAGCAGATAAGTGGTGAGG - Intergenic
1119490168 14:75025199-75025221 CACACAGAAGAAGAGAGATGGGG - Intronic
1119625933 14:76175385-76175407 AGAAAAGCAGAAGAGAGATGGGG - Intronic
1120197876 14:81506085-81506107 TACAAAGCAGATGAAAAGTGGGG - Exonic
1122116630 14:99530805-99530827 CACACAGCAGGTGAGCGCTGGGG + Intronic
1122406049 14:101501724-101501746 CACCCAGCAGGTGAGAGCTGGGG - Intergenic
1123668723 15:22631161-22631183 CACAAAACAGATAAAAGATTTGG - Intergenic
1124524699 15:30437638-30437660 CACAAAACAGATAAAAGATTTGG - Intergenic
1124631963 15:31343138-31343160 CTCAAAGCAGAAGAGAGAAGAGG - Intronic
1124773954 15:32570074-32570096 CACAAAACAGATAAAAGATTTGG + Intergenic
1125078731 15:35651632-35651654 CACAAAACTGATGATAGCTGAGG + Intergenic
1125118685 15:36126182-36126204 CACAAAGCAGAGAAGAGAGTTGG - Intergenic
1125539500 15:40461847-40461869 CTGAAAGCAGATGGGTGATGGGG + Intronic
1126194411 15:45916334-45916356 CAAAGAGAAGATTAGAGATGTGG - Intergenic
1126466418 15:48965025-48965047 AAGAAAGCAGATGAGGAATGAGG - Intergenic
1126738990 15:51759101-51759123 GACAATGCAGATGAGTGAAGTGG + Intronic
1126928432 15:53618782-53618804 CACAAAGTTAATGAAAGATGGGG - Intronic
1128477803 15:68012325-68012347 CAAAAAGCAGGTGAGAGCAGAGG - Intergenic
1128722366 15:69959730-69959752 CACCAAGGAGGTGAGATATGGGG - Intergenic
1128724124 15:69975311-69975333 AGAAAAGCAGAAGAGAGATGGGG + Intergenic
1128842995 15:70865178-70865200 CACTAAGCAGAATAGAGATTTGG - Intronic
1128935871 15:71746096-71746118 AACAGAGCAGATGACAGAGGAGG + Intronic
1129622114 15:77157218-77157240 AAGAAAGGAGATGAGAAATGAGG + Intronic
1129647034 15:77445662-77445684 CCCAAAGCAGAAGAGAAGTGAGG - Intronic
1129764079 15:78149853-78149875 CAGACAGCGGATGAGAGGTGTGG - Intronic
1129770505 15:78200667-78200689 CCCAGAGGAGATGGGAGATGTGG - Intronic
1130047779 15:80459557-80459579 CATAAAGAGGAAGAGAGATGAGG + Intronic
1131784835 15:95901170-95901192 AGCAGAGCAGAAGAGAGATGAGG - Intergenic
1132390404 15:101434419-101434441 CACTAATCAGCTGGGAGATGTGG + Intronic
1132801627 16:1757577-1757599 CAGAAAGCAGAGGAGGGCTGGGG - Intronic
1133081094 16:3320806-3320828 CAGAAAACAGATGAGATATAGGG + Intergenic
1133933387 16:10250228-10250250 CAGAAACCAGAAGAGAGAGGTGG + Intergenic
1137748648 16:50842049-50842071 CACCAAGCAGGTGACAGCTGTGG + Intergenic
1137937589 16:52649364-52649386 CACAAATCTGATGAAAGCTGTGG + Intergenic
1139085194 16:63576334-63576356 CTGAAAGCAGATGAGAAATTTGG + Intergenic
1139301119 16:65946194-65946216 CACAATCCAGGTGAGGGATGAGG - Intergenic
1140255609 16:73333755-73333777 AACAAATCAGATGTGGGATGAGG + Intergenic
1140457933 16:75115448-75115470 CCCAAAACAGATGAGTGAGGAGG + Intronic
1140657324 16:77154158-77154180 AACAAAGCAGGTGAGAAATCTGG + Intergenic
1141013580 16:80426477-80426499 CACAGAGCAGAAGAGAGATTGGG + Intergenic
1141020820 16:80494655-80494677 GCCAAAGCAGATGAGAAATCAGG + Intergenic
1141575402 16:84960143-84960165 CACAAAGCAGATGGAGAATGTGG - Intergenic
1141776360 16:86125330-86125352 CACAGGGCAGCTGATAGATGAGG - Intergenic
1141815941 16:86409264-86409286 CACACAGCAGATGTGTGAGGAGG + Intergenic
1141999624 16:87656745-87656767 CACAAGGCAGAGGAGAAAGGCGG - Intronic
1142250435 16:88989480-88989502 CACAGAGCAGCTGGGAGATGCGG + Intergenic
1142797526 17:2320238-2320260 AAAAAAAAAGATGAGAGATGAGG - Intronic
1142801516 17:2349055-2349077 AACAAAGCAGATGTGGGGTGGGG - Intronic
1144446497 17:15334544-15334566 TACACACCAGATGAGATATGTGG + Intronic
1144694333 17:17291657-17291679 CTGAAAGCAGATGGGGGATGTGG - Intergenic
1145081838 17:19900742-19900764 CAAGAAGCAAATGAGAGACGAGG - Intergenic
1146052047 17:29562091-29562113 CACAGAGCAAATGAGGGAAGTGG + Exonic
1147686996 17:42292164-42292186 CACCAAGAAGATGAGGGACGTGG + Intronic
1147861228 17:43524830-43524852 CACAAACCAGCTGAGAGGAGAGG - Exonic
1148506770 17:48133522-48133544 CACAAAGAAGGTGAGAGAGAAGG - Exonic
1149689078 17:58558562-58558584 CACAAAGCAGGGCAGAGATGGGG + Intronic
1149703098 17:58671895-58671917 CATGAAGTAGGTGAGAGATGGGG - Intronic
1149973008 17:61237783-61237805 CAAAAAGCAGTTAAGAGCTGGGG - Intronic
1150881140 17:69029823-69029845 TCCAAAGAAGATGAGAGAGGAGG + Intronic
1151668177 17:75557523-75557545 CCCAAGGGAGTTGAGAGATGAGG + Intronic
1152107229 17:78337724-78337746 CACAAAGCAGAAGTGAGAATGGG + Intergenic
1152847766 17:82613135-82613157 GACACAACAGAAGAGAGATGAGG + Intronic
1153102393 18:1488402-1488424 GACGAAGCAGAAGATAGATGTGG + Intergenic
1155494470 18:26429161-26429183 GCCACAGCAGATGAGAGAAGAGG + Intergenic
1158581075 18:58683458-58683480 CACAAATCAAAAGAGATATGAGG - Intronic
1158751441 18:60265879-60265901 AACAAAACAGAGGAGAGATCTGG + Intergenic
1160245219 18:77153240-77153262 CACACAGAAGATGAGAGATCGGG - Intergenic
1160608029 18:80066776-80066798 CCCAAAGGACATGAGAGCTGAGG + Intronic
1163193617 19:15697709-15697731 CACATAGCAGAAGAGAGTAGGGG - Intergenic
1163199902 19:15759768-15759790 CACATAGCAGAGGAGAGTAGGGG + Intergenic
1163701568 19:18789147-18789169 CAACAAGCAGGTGAGAGGTGTGG - Exonic
1165075320 19:33277073-33277095 CACAAAGGAAAGGAGAGCTGAGG + Intergenic
1165077755 19:33290283-33290305 CACACAGCAGGTGTGTGATGAGG + Intergenic
1165726270 19:38115167-38115189 CTGAAAGCTGATGAGAGCTGTGG + Intronic
1166060310 19:40321649-40321671 CACAGAGGACATGAGAGAAGGGG + Exonic
1167634331 19:50645348-50645370 CACACAGAAGCAGAGAGATGGGG + Intronic
1167636192 19:50657271-50657293 CACAAAGAAGTGGAGTGATGGGG - Intronic
1167801086 19:51742590-51742612 CACAGAGCTTATAAGAGATGAGG + Intergenic
925104548 2:1279641-1279663 CACGCAGCACATCAGAGATGCGG - Intronic
925211750 2:2054634-2054656 CACAGAGATGATGAGAGATACGG + Intronic
925263206 2:2546051-2546073 GACAGAGCAGAAGAGTGATGGGG - Intergenic
925394622 2:3524320-3524342 AACAAAAAAGATGAGAGCTGTGG - Intergenic
925459142 2:4044746-4044768 AGCAAAGCAGATGAGAAATTAGG + Intergenic
925539100 2:4947078-4947100 TAGAAAGCAGATGACACATGTGG + Intergenic
925601325 2:5611328-5611350 AACAAAGCAGGTGGGAGAAGGGG - Intergenic
925699457 2:6619275-6619297 CAGAAAGCAGATCAGTGATTTGG - Intergenic
927234584 2:20858874-20858896 TACAAATCAGGTGAGAGATCTGG + Intergenic
927317559 2:21702838-21702860 CACAAAGCAAATTTGGGATGGGG + Intergenic
927857687 2:26537573-26537595 CAGGAAGCAGCTGAGAGGTGAGG + Intronic
928446951 2:31341077-31341099 CAAAAACAAGATGAGAAATGAGG - Intronic
929081602 2:38127642-38127664 TACAAAGAGGATGAGAGTTGAGG + Intergenic
932352990 2:71046850-71046872 CCCAGAGCAGATAAGAGAGGAGG + Intergenic
932583516 2:73008037-73008059 AAAAAAGCAGAGGAGGGATGAGG + Intronic
933262143 2:80142621-80142643 CACAATGCATATGAGCAATGAGG + Intronic
935987006 2:108684082-108684104 CTCAAAGCAGTTGAGAGAAGAGG + Exonic
936385060 2:112022007-112022029 CACTAAGCAGATGTGTGACGAGG + Intronic
936685682 2:114823562-114823584 CCCAAAGGAGATTAGAGCTGCGG + Intronic
937306084 2:120871918-120871940 CAGAAATCAGCTGAGAGTTGTGG + Intronic
937473396 2:122192619-122192641 CACATAGCTGATAAGTGATGGGG + Intergenic
937797290 2:126038761-126038783 CACATAGCAGAAGGGAGATAAGG + Intergenic
938311741 2:130294480-130294502 AAAAAAAAAGATGAGAGATGAGG + Intergenic
940424165 2:153511833-153511855 CACAAAGGAAATGAGAGGTAGGG + Intergenic
941250590 2:163156847-163156869 CAGAAGGAAGATGAGAGATGGGG - Intergenic
941342626 2:164327227-164327249 AACAAAGCATTTGAGAGATATGG - Intergenic
942789842 2:179748180-179748202 CACAAAGCAGAGCAGATATGTGG + Intronic
944164413 2:196702909-196702931 CAGAAAGCAGATGGGAGAGTGGG + Intronic
944587272 2:201183574-201183596 CACAAGGCAAATGCTAGATGCGG + Intronic
944938014 2:204589891-204589913 CAGTGAGCAGATGGGAGATGGGG + Intronic
946203454 2:218085616-218085638 CACATGGCAGAAGTGAGATGAGG + Intronic
947301738 2:228695592-228695614 TACAAACCAGAAGAGAGTTGGGG - Intergenic
947837238 2:233184629-233184651 CACGAAGCTGATCAGAGAAGTGG + Intronic
948066630 2:235086009-235086031 CAGAGAGCACAGGAGAGATGGGG + Intergenic
948720352 2:239895338-239895360 CACAGAGCATATGAGTGAGGAGG + Intronic
1168862669 20:1057099-1057121 CACAGAGCAGATGCCACATGAGG + Intergenic
1168989035 20:2078743-2078765 AGCAATCCAGATGAGAGATGGGG + Intergenic
1169933463 20:10858284-10858306 CAGAAAGCAGAGGAGGGATAGGG - Intergenic
1170717583 20:18845354-18845376 CACTGAGCAGTTGAGGGATGAGG + Intergenic
1172409811 20:34712443-34712465 AACCAAGCAGGTGAGAGATTGGG - Exonic
1172512493 20:35510192-35510214 CCCTAGGCATATGAGAGATGGGG - Intronic
1172723838 20:37020747-37020769 CAAAAAGCAGTTGATAAATGCGG - Intronic
1172900989 20:38334806-38334828 CACAGAGCAGGCAAGAGATGGGG + Intronic
1172901301 20:38336800-38336822 CACAAAGAAGCAGAGAGAAGTGG + Intronic
1174434311 20:50494733-50494755 CACAAAGCAGGTGTGTAATGGGG + Intergenic
1174664564 20:52245877-52245899 GACAAAGTAAATGAGAGAGGAGG + Intergenic
1175450894 20:59066695-59066717 GACAAAACAGATAAAAGATGAGG + Intergenic
1175805434 20:61825912-61825934 GACAAATCGGATGTGAGATGTGG - Intronic
1175840777 20:62025821-62025843 CAGAAAGCAGATGGGACAAGGGG + Intronic
1175978813 20:62726956-62726978 CACAAAGCAGTTTCCAGATGGGG - Intronic
1176347027 21:5757903-5757925 CAGAATGCAGATGAGGGAGGAGG + Intergenic
1176353841 21:5878487-5878509 CAGAATGCAGATGAGGGAGGAGG + Intergenic
1176424750 21:6541292-6541314 CAAAACGCAGGTGAGAGCTGTGG - Intergenic
1176497800 21:7566552-7566574 CAGAATGCAGATGAGGGAGGAGG - Intergenic
1176541348 21:8155973-8155995 CAGAATGCAGATGAGGGAGGAGG + Intergenic
1176560299 21:8339018-8339040 CAGAATGCAGATGAGGGAGGAGG + Intergenic
1177136573 21:17310454-17310476 TACAAACCAGAAGAGAGTTGGGG + Intergenic
1177646642 21:23907165-23907187 CCCAAAGCAGGTGAGTGATGGGG - Intergenic
1177824341 21:26065613-26065635 CACAAAGCTAATGACAGAGGTGG + Intronic
1179060215 21:37972628-37972650 CACTAAGCAGAGGAGAGACCAGG - Intronic
1179336173 21:40457012-40457034 GACAAAGAAGATGAGAGATAAGG + Intronic
1179373448 21:40828277-40828299 CTTTAAGCAGATGGGAGATGTGG + Intronic
1179700239 21:43149601-43149623 CAAAACGCAGGTGAGAGCTGTGG - Intergenic
1180534567 22:16386843-16386865 CAAAAAGCGGAGGTGAGATGGGG - Intergenic
1180991287 22:19938348-19938370 AACAAAGGAGATAAGACATGGGG + Intronic
1181381262 22:22506594-22506616 AAACAAGCAGATGGGAGATGTGG + Intronic
1184357243 22:43990612-43990634 CACAAAGCACCTGAGGGAGGGGG - Intronic
1184512796 22:44943041-44943063 CACAAAGTAGATGGAAGATCCGG + Intronic
1185171716 22:49298189-49298211 CTGGAAGCAGAGGAGAGATGGGG + Intergenic
1185270431 22:49927072-49927094 CACAAAGCAGATGAGAGATGAGG - Intronic
1203246289 22_KI270733v1_random:72392-72414 CAGAATGCAGATGAGGGAGGAGG + Intergenic
949106062 3:201158-201180 CACAAAGTAGAGTAGAGCTGTGG + Intronic
949349428 3:3110519-3110541 CACAAAGCAGAGAAGAGCTAAGG - Intronic
949458212 3:4262049-4262071 CACAGAGAATATCAGAGATGTGG - Intronic
949461218 3:4296963-4296985 AATAAAGCAGATGAGTGATAAGG - Intronic
949489902 3:4579126-4579148 CACACAGCTGATGAGCTATGGGG - Intronic
950898377 3:16474275-16474297 CACAGAGCAAATGAGAGAGATGG + Intronic
951380486 3:21977941-21977963 CAAAAAGCAGAGGAGAGAATTGG - Intronic
951971732 3:28453220-28453242 CAAAAAGCAGAATAGAGATAGGG - Intronic
952252810 3:31671196-31671218 CAGAAAGCAGAAGAGAAAGGTGG + Intronic
953409427 3:42681796-42681818 CAGAAAGCAGATCAGTGATTGGG + Intergenic
953583990 3:44183245-44183267 CAAGAAGCAGATAGGAGATGAGG + Intergenic
954436022 3:50496775-50496797 CACACAGCTGTTGAGAGGTGTGG + Intronic
957024459 3:75165728-75165750 AACAAAGAAGTTGAAAGATGGGG + Intergenic
957428671 3:80072659-80072681 CACTATGCAGATGAGAGACCTGG + Intergenic
959116890 3:102189175-102189197 AAAAAAGCAAATGAGAGAAGTGG - Intronic
959186933 3:103056694-103056716 CACAAAGAAGATAAGAGTCGAGG + Intergenic
959888140 3:111525767-111525789 AACAAAGGAGATAAGACATGGGG + Intronic
960320501 3:116229712-116229734 CTCAAAGAAGATCAGAGATATGG + Intronic
960445621 3:117745732-117745754 CACATCACAGGTGAGAGATGTGG + Intergenic
960600061 3:119448025-119448047 CACCAAGCAAATTAGAGGTGAGG - Intronic
960743029 3:120855809-120855831 CATAACACAGAAGAGAGATGGGG + Intergenic
961615521 3:128176420-128176442 CACACACCAGAAGAGAAATGTGG + Intronic
962156348 3:132952611-132952633 AACCCAGGAGATGAGAGATGAGG - Intergenic
962266928 3:133950481-133950503 CAGAGACCAGGTGAGAGATGGGG - Intronic
962319697 3:134380182-134380204 CACCAAGCAGATGCAAAATGAGG - Intergenic
962393426 3:134992999-134993021 CACAAGGCAGGTGACACATGAGG - Intronic
962752570 3:138444659-138444681 CAGAAAGCAGGTATGAGATGGGG + Intronic
962979654 3:140476429-140476451 CACTTCTCAGATGAGAGATGTGG - Intronic
963105317 3:141642104-141642126 TACAAAGCATAAGAGAGAGGAGG + Intergenic
963526458 3:146421155-146421177 CATAAATCAGAAGAAAGATGGGG + Intronic
963837572 3:150072445-150072467 CAGAAATCAGATCAGGGATGGGG - Intergenic
964239223 3:154572342-154572364 TAAAAAGCAGAAGAGAGAAGGGG - Intergenic
964646457 3:158963273-158963295 CAGAAAGCAGATGACAGTGGTGG + Intronic
965623007 3:170659338-170659360 CACACAGCATCTGACAGATGTGG + Intronic
966384066 3:179376407-179376429 CACAAAGAAGATGTGATTTGAGG + Intronic
966394636 3:179489876-179489898 CGCAAAGCAGTTGGGAAATGTGG - Intergenic
966910092 3:184554811-184554833 CACAAAGCTAATGGGAAATGGGG + Intronic
967353682 3:188543957-188543979 CAGAAAGCAGAGGAGGCATGTGG + Intronic
967885321 3:194329727-194329749 CACAGAGCAGCTGAGTGCTGGGG + Intergenic
968561489 4:1285522-1285544 CACAAGGCAGATGACACATTTGG - Intergenic
969104888 4:4798711-4798733 CACAAAGGAGAAGAGAGAAAGGG + Intergenic
969604102 4:8193689-8193711 CACAAAGCAGAGCTGAGATGGGG + Intronic
970982509 4:22117199-22117221 AACAAAGCACGAGAGAGATGTGG + Intergenic
971923389 4:32972938-32972960 AACAAAGCAGATGAAAGAAGAGG - Intergenic
972165538 4:36279669-36279691 AACAGAGCAGATGAGAGAAGGGG - Intergenic
972805484 4:42526233-42526255 GAAAAAGCAGAAGAAAGATGTGG + Intronic
973684038 4:53351208-53351230 AACAGAGCAGATGACAGAAGTGG + Intronic
976420543 4:84838558-84838580 CCCAAACCACATGAGAGATGGGG + Intronic
977741787 4:100492881-100492903 CACATAGCTGATAAGTGATGGGG - Intronic
978233045 4:106424064-106424086 CAGAAGGGAGATGAGAGATCAGG + Intergenic
979279632 4:118850905-118850927 CACAAAAGAGATGAGACAAGAGG + Intronic
980086472 4:128395633-128395655 TACAAAAGAGAAGAGAGATGGGG - Intergenic
980205368 4:129712600-129712622 AAAAAGGCAGAAGAGAGATGAGG + Intergenic
980667965 4:135963396-135963418 CACAGAGGAGATAAAAGATGAGG + Intergenic
981995306 4:150967883-150967905 CAAAAAGAGGAAGAGAGATGGGG - Intronic
982702597 4:158672576-158672598 GAGAAAGCTGATGAGAGAAGGGG - Intronic
983190525 4:164749394-164749416 AACAAAGGAGATAAGACATGGGG + Intergenic
984084351 4:175290099-175290121 CAGGAAGAAGAGGAGAGATGAGG + Intergenic
984526977 4:180868877-180868899 CACAAAACAGACTAAAGATGTGG - Intergenic
984809486 4:183782212-183782234 CTGAAGGCAGAAGAGAGATGTGG - Intergenic
984943122 4:184951584-184951606 CAGAAAGCAGATTAGTGAAGGGG + Intergenic
985091174 4:186363982-186364004 AACAAAGCAGATGGCAGGTGAGG - Intergenic
985659963 5:1152120-1152142 CACAAAGCAAAGGAGAGGGGAGG - Intergenic
986290204 5:6393612-6393634 CACAAAGCAGCTTAGAGTAGTGG - Intergenic
987244252 5:16032432-16032454 CACAAAGCAGAAGTGAGGTGGGG - Intergenic
991248349 5:64531973-64531995 CACATAGCAAAAGAGAGAGGGGG - Intronic
991248403 5:64532732-64532754 CACAAATAATATGAGAGGTGGGG - Intronic
991484862 5:67124289-67124311 CAAAAAGCAGAGAAGAAATGTGG + Intronic
991650361 5:68846508-68846530 CACAAAGTGGATAAGAAATGTGG + Intergenic
991960997 5:72044115-72044137 CATAAAGAAGATTACAGATGAGG - Intergenic
992578439 5:78145420-78145442 CACTAACCAGCTGTGAGATGTGG - Intronic
993386402 5:87267957-87267979 CACCAGGCAGATGAGAGGGGTGG - Exonic
994202045 5:96988169-96988191 AACACAGCAGATGAGAGAAAGGG - Intronic
994658070 5:102619292-102619314 GAAAAATCAGATGAGAGATCTGG + Intergenic
995113179 5:108450450-108450472 CACAAAGTGGGAGAGAGATGAGG - Intergenic
996245710 5:121261963-121261985 CACAAACCAGAAGAGATTTGGGG - Intergenic
996592464 5:125162508-125162530 TACAAATCAGAAGAGAGAGGGGG + Intergenic
997564990 5:134880103-134880125 CACAAAGCTGATGAGAAAGCAGG - Intronic
998449380 5:142222591-142222613 CTCACAGCAGATGTGAGAGGTGG + Intergenic
998629649 5:143883988-143884010 CACAAACTAAATGAAAGATGGGG - Intergenic
1000619179 5:163463060-163463082 CACATAGCAGACCTGAGATGGGG - Intronic
1001244992 5:170099299-170099321 GAGAAAGCTGATGAGTGATGTGG - Intergenic
1001836184 5:174834693-174834715 CAGAATGCAGAAAAGAGATGAGG - Intergenic
1003506474 6:6744523-6744545 CACAAAACTGATGAGCCATGAGG + Intergenic
1004595670 6:17097277-17097299 CACAATGTATATGAGGGATGAGG + Intergenic
1005444477 6:25907502-25907524 CACACAGCAGATAAAAGAAGAGG + Intergenic
1006751589 6:36381251-36381273 CTCAAAGCAAATGACAGCTGTGG + Intronic
1008489144 6:52067152-52067174 GACAAAGCAGAGGAGACATATGG + Intronic
1008560929 6:52723917-52723939 CAAAAAGCAGATGAGTGGTATGG - Intergenic
1008902495 6:56637368-56637390 CACAAAGCAGATGTAAGAGTTGG - Intronic
1009279939 6:61736316-61736338 CACAAAGGAGATGAGACCTTGGG - Intronic
1009662132 6:66627613-66627635 CACAAAACTGAGCAGAGATGAGG - Intergenic
1009729085 6:67576130-67576152 AACAAAGTAGATGAGAAATACGG - Intergenic
1010492567 6:76493069-76493091 AACAAAGGAGATAAGACATGTGG - Intergenic
1010844226 6:80685027-80685049 CACAAACCAGAAGAGAGTGGGGG + Intergenic
1012618125 6:101302971-101302993 CACAGAGCAGCTGTGAAATGAGG - Intergenic
1013038667 6:106411933-106411955 AACAAAGCAGGTGAAAGAAGAGG - Intergenic
1013659882 6:112284322-112284344 CAGACAGCAAATGAGACATGGGG - Intergenic
1015218297 6:130775589-130775611 CACACAGCAGATGGCAGAGGTGG - Intergenic
1017053570 6:150417675-150417697 CAGAACGCAGATGAGAGAGCAGG + Intergenic
1017120644 6:151020936-151020958 CACATAGCAGATGGGATGTGCGG - Intronic
1017418117 6:154243503-154243525 CATAAAACAGAAGAGAGGTGAGG + Intronic
1019374959 7:684604-684626 CACAGAGCAGAGGACAGAGGTGG + Intronic
1019981654 7:4626074-4626096 AATAAGGCAGATGAGAGATAAGG + Intergenic
1020237526 7:6367798-6367820 CACAAAGCCGAAGAGAGAAGGGG - Intergenic
1021864995 7:24946853-24946875 CACAAAGCAGATGATATAGATGG - Intronic
1022383472 7:29882106-29882128 CACCAACCAAATGAGAAATGTGG - Intronic
1022416753 7:30185034-30185056 CACAAGGCAGATGTGATCTGGGG - Intergenic
1022479035 7:30731084-30731106 CACACAGCTGATGAGAGATGTGG + Intronic
1023363759 7:39442557-39442579 AATAAACCAGCTGAGAGATGGGG - Intronic
1024491562 7:49991216-49991238 CAGAATGCAAATAAGAGATGGGG + Intronic
1024987477 7:55207969-55207991 CAAGAAGCAGATGATCGATGAGG + Exonic
1026983302 7:74538913-74538935 CACAACGCAGGGGACAGATGTGG - Intronic
1027303945 7:76872521-76872543 AATAATGCAGATGAGAGATGAGG + Intergenic
1027678842 7:81193401-81193423 CCCAAAGCAGAGAAGAGAGGGGG + Intronic
1027801666 7:82759989-82760011 CAGTAAGGAGATGAAAGATGTGG + Intronic
1028554440 7:92106986-92107008 CTCTAAGTAGATGAGAGGTGAGG - Intronic
1029410987 7:100410509-100410531 TACAAGGGAGATGAGAGGTGAGG - Intronic
1029584185 7:101459640-101459662 CACCAAGCCAATGTGAGATGGGG - Intronic
1029867714 7:103653223-103653245 CACAAAGCTGATTTGATATGAGG + Intronic
1030483691 7:110138428-110138450 GCCAAAGGATATGAGAGATGGGG - Intergenic
1031007740 7:116493631-116493653 CACAAAGCAGATGGAAGACTGGG - Intronic
1031453880 7:121956019-121956041 CCCATACCAGATTAGAGATGGGG + Intronic
1032236960 7:130132933-130132955 CAGAGAGCTGAAGAGAGATGTGG + Exonic
1032581312 7:133105844-133105866 CTCACAGCAGCTGGGAGATGAGG - Intergenic
1033532944 7:142284486-142284508 TACACAGAAGATGAGAGATCAGG - Intergenic
1034080902 7:148276859-148276881 CACAAAGCAGCTCACATATGTGG + Intronic
1034528507 7:151681160-151681182 CCCAAAGGAGGTGAGAGAGGTGG + Intronic
1034556954 7:151856250-151856272 CACACAGCCAATGAGAGGTGTGG + Intronic
1035332594 7:158106012-158106034 AATAAAACAGAAGAGAGATGGGG - Intronic
1035952924 8:4044145-4044167 AAGAAAGAAGATGAGAGTTGGGG + Intronic
1036147780 8:6270502-6270524 CAGGAAGGAGATGAGCGATGGGG + Intergenic
1036169003 8:6465041-6465063 CACTGAGCAAAGGAGAGATGTGG + Intronic
1036812199 8:11874850-11874872 CACAAGGCTGTTGTGAGATGAGG + Intergenic
1037501401 8:19489051-19489073 GAAAATGGAGATGAGAGATGGGG + Intronic
1037523991 8:19707002-19707024 CACTAAGGATATGTGAGATGGGG + Intronic
1037643128 8:20766792-20766814 CACAAGACAGATGTGAGAAGGGG - Intergenic
1037897024 8:22664423-22664445 CACAGAGGACATGAGTGATGAGG + Intronic
1038370504 8:26984841-26984863 CACAAAGCAGAAGACAAATGTGG + Intergenic
1039026752 8:33267066-33267088 CACAAAACAGAGCTGAGATGAGG + Intergenic
1040352688 8:46584593-46584615 AACAAAGGAGATGAGACACGTGG + Intergenic
1040485023 8:47862427-47862449 GACACAGCAGATGACAGATATGG + Exonic
1041811223 8:61912835-61912857 CACAAAGCAGAACACACATGTGG + Intergenic
1041955594 8:63555341-63555363 GAGAAAGTAGATTAGAGATGGGG + Intergenic
1042216003 8:66429995-66430017 CAATAAGCAGATGAGGGAGGAGG + Exonic
1042328759 8:67556064-67556086 CACCATGCAGAACAGAGATGTGG + Intronic
1042406646 8:68413227-68413249 GAAATAGTAGATGAGAGATGAGG - Intronic
1044374570 8:91454445-91454467 CACACAGCAGTTGAGAGCTTGGG - Intergenic
1044421176 8:91997553-91997575 CAGAAAGCAAAAGAGAAATGAGG - Intronic
1045202971 8:100005800-100005822 AACAAAGCAGATGAGGTATTTGG - Intronic
1045301009 8:100910106-100910128 CACAAAACAGGTCACAGATGAGG - Intergenic
1045855545 8:106761323-106761345 CACAAAGGAGATGAGGGCTATGG - Exonic
1046065559 8:109192884-109192906 AAGAAAGCACATGTGAGATGGGG + Intergenic
1046412815 8:113870435-113870457 CACAAAATAGATGAGACAAGCGG - Intergenic
1047789101 8:128184422-128184444 CACATATCAGAAGGGAGATGAGG - Intergenic
1047931719 8:129734491-129734513 CACAAGCCAGATGAGAGTGGGGG + Intergenic
1049323046 8:142007365-142007387 CACAAAGGGGCTGAGAGAGGAGG - Intergenic
1049470969 8:142774850-142774872 CACTGAGCAGATGGGAGCTGTGG - Intronic
1051221196 9:14850215-14850237 TACAAAACAGAGGAGAGAGGTGG + Intronic
1051254024 9:15193202-15193224 AAGAAAGCAGAGGACAGATGGGG - Intronic
1052459473 9:28743963-28743985 AACAAAGCAGTAGAGAAATGGGG - Intergenic
1053354225 9:37432860-37432882 CACAAAGCAGAAGAGAGAAGGGG - Intronic
1054823133 9:69543721-69543743 CACAAAGCAGATAATTGGTGGGG + Intronic
1055704452 9:78982218-78982240 AACATAGCAGAGGAGAGATTGGG - Intergenic
1056175862 9:84035374-84035396 CACATGGAAGGTGAGAGATGAGG - Intergenic
1059428838 9:114237815-114237837 CACACAGGATATGAGAGATGAGG + Intronic
1060647341 9:125292276-125292298 CACAAAGCTGTTTAGAGATTTGG + Intronic
1061769957 9:132911410-132911432 CAGAAAGCAGAGGAGAGAGCAGG + Intronic
1062118045 9:134819588-134819610 CCCAAGGCAAATGAGAGCTGGGG + Intronic
1203462622 Un_GL000220v1:55464-55486 CAGAATGCAGATGAGGGAGGAGG + Intergenic
1186514922 X:10159826-10159848 AGCAAAGCAGATGATAGAGGTGG + Intronic
1188561819 X:31477119-31477141 CAGAGATCAGAAGAGAGATGCGG + Intronic
1188605278 X:32021266-32021288 CACAGAGAAGATTAGAGATGGGG + Intronic
1188682702 X:33031149-33031171 CACAAAGAAACAGAGAGATGTGG - Intronic
1189062245 X:37766956-37766978 GACAAAGCACATAAGACATGTGG + Intronic
1189351656 X:40280110-40280132 GACAAAGCAGATGGCGGATGGGG - Intergenic
1189479671 X:41382947-41382969 CAAAAAGCAGAAGAGAGAAGGGG - Intergenic
1189784345 X:44546010-44546032 CACAATTAAGATGAGAGATTGGG + Intergenic
1189882972 X:45511180-45511202 CACTAAGTAGAAGAGATATGAGG + Intergenic
1191625373 X:63265403-63265425 TACAAGCCAGAAGAGAGATGGGG - Intergenic
1193041881 X:77012508-77012530 CACAAAGCACAATATAGATGTGG - Intergenic
1193455503 X:81726613-81726635 TACAAACCAGAAGAGAAATGGGG + Intergenic
1196020460 X:110985557-110985579 CTCAAAGCACACTAGAGATGAGG - Intronic
1196379362 X:115072010-115072032 CACAAAGTAGATGTGTGTTGTGG - Intergenic
1196897565 X:120352726-120352748 CACTAAGCAGAAAAGAGAAGAGG + Intergenic
1197330046 X:125142457-125142479 GGCAAAGCAGATGAGAGAGTGGG + Intergenic
1197406189 X:126054221-126054243 CACAAACCAGAAAATAGATGGGG - Intergenic
1197809748 X:130430619-130430641 TTCAAAGCAGCTCAGAGATGGGG - Intergenic
1197841100 X:130747611-130747633 CACAAAGCAGCTCTGAGCTGTGG + Intronic
1198614170 X:138436426-138436448 CTCAAAGAGGATGAGACATGAGG - Intergenic
1200031165 X:153297011-153297033 GACAAAGGAGATGATTGATGGGG + Intergenic