ID: 1185270444

View in Genome Browser
Species Human (GRCh38)
Location 22:49927117-49927139
Sequence CCCTTGGATGGCTGCGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270431_1185270444 22 Left 1185270431 22:49927072-49927094 CCTCATCTCTCATCTGCTTTGTG 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 70
1185270430_1185270444 29 Left 1185270430 22:49927065-49927087 CCGTCTGCCTCATCTCTCATCTG 0: 1
1: 1
2: 5
3: 56
4: 544
Right 1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270444 Original CRISPR CCCTTGGATGGCTGCGTCCG GGG Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
901233912 1:7657221-7657243 CCCTAGGAAGGCTGGGTCAGGGG - Intronic
902817222 1:18923219-18923241 CCCCTGGGTGCCTGCGTCCAAGG - Intronic
903656835 1:24954694-24954716 TCCGTGGATGGCCACGTCCGTGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
904465973 1:30707745-30707767 GCTTTGGATGGCAGAGTCCGTGG + Intergenic
907043474 1:51284238-51284260 ACCTTGGAAGGCTGCATCTGAGG + Intergenic
918870554 1:189968500-189968522 ACCTTGGCTGGCTGTGTCAGAGG - Intergenic
919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG + Intronic
1078558838 11:12353381-12353403 CCTTTGGATGGCTTCTTCCCTGG + Intronic
1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG + Exonic
1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG + Intergenic
1092738593 12:11607292-11607314 TCCTTGGATGGCTGACTCTGGGG - Intergenic
1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG + Intronic
1105212399 13:18264886-18264908 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
1107058277 13:36130103-36130125 CCCTGTGATGTCTACGTCCGTGG - Intronic
1135938829 16:26803434-26803456 CCCTTTGATGGCTGCATGCAGGG + Intergenic
1136624461 16:31453550-31453572 CCCTTGCATGCCTGGGTCAGAGG - Intergenic
1139955639 16:70691765-70691787 CCCTCGGATGGCTGAGTGTGGGG - Intronic
1140404074 16:74696098-74696120 CCCTTGGTTGGCTGGATGCGTGG + Intronic
1141614890 16:85204818-85204840 CCCTTGGCTGGCTGGGTGTGGGG - Intergenic
1141811517 16:86379275-86379297 CCCTTGGTGGGCTGCTTCCCTGG - Intergenic
1142003778 16:87679598-87679620 CCACTGGATGAATGCGTCCGGGG - Intronic
1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG + Exonic
1143877647 17:10004228-10004250 CACTTGGATGGCTTCTTGCGGGG - Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1151871804 17:76841681-76841703 CCCTTGCGTGGCTGCATCAGAGG - Intergenic
1160946836 19:1647638-1647660 CCCTTGGAGGTCTGGGTCCAGGG - Intronic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1168375929 19:55879235-55879257 TCCTTGGATCTCTGCGTCCTTGG - Intronic
933903072 2:86862704-86862726 CCCTTGGAGGGCTGCGGGAGAGG + Intergenic
934301224 2:91777516-91777538 CCCTTGGATTGCTGTGTAAGGGG + Intergenic
935777474 2:106486566-106486588 CCCTTGGAGGGCTGCGGGAGAGG - Intergenic
939968856 2:148638175-148638197 CCCTTGTATGGCTGAGTAAGAGG + Intergenic
945102434 2:206274693-206274715 GCCTTGGATGCCTGCGTGAGTGG + Exonic
947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG + Intronic
948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG + Intronic
1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG + Intergenic
1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG + Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1180815215 22:18785205-18785227 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
1181201405 22:21219542-21219564 CCCTTGGATTGCTGTGTAAGGGG - Intronic
1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185314032 22:50171062-50171084 CCGTGGCCTGGCTGCGTCCGCGG + Intronic
1203225509 22_KI270731v1_random:75888-75910 CCCTTGGATTGCTGTGTAAGGGG + Intergenic
1203265321 22_KI270734v1_random:10896-10918 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
961557519 3:127706808-127706830 CCCGTGGAAGGCTGTGTCCTGGG + Intronic
969447341 4:7252903-7252925 CCCTTAGCTGGCTGGGTACGTGG + Intronic
973917839 4:55654581-55654603 CCCTTGTGTGGCTGGGTCTGGGG + Intergenic
991457355 5:66818703-66818725 CCCTTGGATTGCTGCTGCAGTGG + Intronic
995253172 5:110017696-110017718 TCTTTGGATGGCTGTGTCAGTGG - Intergenic
999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG + Exonic
1002421097 5:179149466-179149488 ACCGTGGAAGGCTGCGGCCGGGG + Intronic
1006034290 6:31199486-31199508 ACCTTGGATTGCTGGGTCGGGGG + Intronic
1006439364 6:34043590-34043612 CCCATGGCTGGGTGCGTCCTTGG - Intronic
1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG + Intergenic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG + Intergenic
1039972380 8:42331202-42331224 CCCACGGAGGGCTGCGTCCTGGG - Exonic
1047922746 8:129652164-129652186 CCCTGGGCTGGCTGCTTTCGGGG - Intergenic
1048216973 8:132505236-132505258 CCCTTGTATGGATGCTTCAGAGG - Intergenic
1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG + Intronic
1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG + Intronic
1055090912 9:72364568-72364590 GCCGCGGATGGCGGCGTCCGGGG - Exonic
1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG + Intergenic
1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG + Intergenic
1062069852 9:134549784-134549806 CCCTCAGATGGCTGCCTCGGTGG - Intergenic
1186933466 X:14420527-14420549 CCCTTTGAGAGCTGCGTCCCTGG - Intergenic
1187018689 X:15357333-15357355 CCCATGGAGGGCAGCGTCCTGGG - Intronic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic