ID: 1185270978

View in Genome Browser
Species Human (GRCh38)
Location 22:49929268-49929290
Sequence CTGGCCCCGACCCCCCTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270978_1185270986 4 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270986 22:49929295-49929317 GGAGAGGTGCCCGCGGGACACGG No data
1185270978_1185270983 -3 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270983 22:49929288-49929310 CAGGCCAGGAGAGGTGCCCGCGG No data
1185270978_1185270990 11 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG No data
1185270978_1185270993 13 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270993 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
1185270978_1185270995 18 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270995 22:49929309-49929331 GGGACACGGGGGACGGGGACTGG No data
1185270978_1185270997 20 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270997 22:49929311-49929333 GACACGGGGGACGGGGACTGGGG No data
1185270978_1185271000 23 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185271000 22:49929314-49929336 ACGGGGGACGGGGACTGGGGGGG No data
1185270978_1185270996 19 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270996 22:49929310-49929332 GGACACGGGGGACGGGGACTGGG No data
1185270978_1185270998 21 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270998 22:49929312-49929334 ACACGGGGGACGGGGACTGGGGG No data
1185270978_1185271002 27 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data
1185270978_1185270989 7 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270989 22:49929298-49929320 GAGGTGCCCGCGGGACACGGGGG No data
1185270978_1185270999 22 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270999 22:49929313-49929335 CACGGGGGACGGGGACTGGGGGG No data
1185270978_1185271001 24 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185271001 22:49929315-49929337 CGGGGGACGGGGACTGGGGGGGG No data
1185270978_1185270984 -2 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270984 22:49929289-49929311 AGGCCAGGAGAGGTGCCCGCGGG No data
1185270978_1185270988 6 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270988 22:49929297-49929319 AGAGGTGCCCGCGGGACACGGGG No data
1185270978_1185270987 5 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270987 22:49929296-49929318 GAGAGGTGCCCGCGGGACACGGG No data
1185270978_1185270991 12 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270991 22:49929303-49929325 GCCCGCGGGACACGGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270978 Original CRISPR CTGGCCCCGACCCCCCTCCG AGG (reversed) Intergenic