ID: 1185270982

View in Genome Browser
Species Human (GRCh38)
Location 22:49929287-49929309
Sequence CGCGGGCACCTCTCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270982_1185270995 -1 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270995 22:49929309-49929331 GGGACACGGGGGACGGGGACTGG No data
1185270982_1185270997 1 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270997 22:49929311-49929333 GACACGGGGGACGGGGACTGGGG No data
1185270982_1185271003 17 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271003 22:49929327-49929349 ACTGGGGGGGGCGGTTGAGCAGG No data
1185270982_1185271001 5 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271001 22:49929315-49929337 CGGGGGACGGGGACTGGGGGGGG No data
1185270982_1185270991 -7 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270991 22:49929303-49929325 GCCCGCGGGACACGGGGGACGGG No data
1185270982_1185270993 -6 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270993 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
1185270982_1185270998 2 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270998 22:49929312-49929334 ACACGGGGGACGGGGACTGGGGG No data
1185270982_1185270999 3 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270999 22:49929313-49929335 CACGGGGGACGGGGACTGGGGGG No data
1185270982_1185271000 4 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271000 22:49929314-49929336 ACGGGGGACGGGGACTGGGGGGG No data
1185270982_1185270996 0 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270996 22:49929310-49929332 GGACACGGGGGACGGGGACTGGG No data
1185270982_1185271004 22 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271004 22:49929332-49929354 GGGGGGCGGTTGAGCAGGAATGG No data
1185270982_1185271006 24 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271006 22:49929334-49929356 GGGGCGGTTGAGCAGGAATGGGG No data
1185270982_1185271005 23 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data
1185270982_1185270990 -8 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG No data
1185270982_1185271007 25 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271007 22:49929335-49929357 GGGCGGTTGAGCAGGAATGGGGG No data
1185270982_1185271002 8 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270982 Original CRISPR CGCGGGCACCTCTCCTGGCC TGG (reversed) Intergenic