ID: 1185270990

View in Genome Browser
Species Human (GRCh38)
Location 22:49929302-49929324
Sequence TGCCCGCGGGACACGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270968_1185270990 30 Left 1185270968 22:49929249-49929271 CCAGTGAACGCTAGGGAGTCCTC No data
Right 1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG No data
1185270978_1185270990 11 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG No data
1185270982_1185270990 -8 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270990 Original CRISPR TGCCCGCGGGACACGGGGGA CGG Intergenic