ID: 1185270991

View in Genome Browser
Species Human (GRCh38)
Location 22:49929303-49929325
Sequence GCCCGCGGGACACGGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270978_1185270991 12 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270991 22:49929303-49929325 GCCCGCGGGACACGGGGGACGGG No data
1185270982_1185270991 -7 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270991 22:49929303-49929325 GCCCGCGGGACACGGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270991 Original CRISPR GCCCGCGGGACACGGGGGAC GGG Intergenic