ID: 1185270992

View in Genome Browser
Species Human (GRCh38)
Location 22:49929304-49929326
Sequence CCCCGTCCCCCGTGTCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270992_1185271004 5 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271004 22:49929332-49929354 GGGGGGCGGTTGAGCAGGAATGG No data
1185270992_1185271006 7 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271006 22:49929334-49929356 GGGGCGGTTGAGCAGGAATGGGG No data
1185270992_1185271007 8 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271007 22:49929335-49929357 GGGCGGTTGAGCAGGAATGGGGG No data
1185270992_1185271005 6 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data
1185270992_1185271003 0 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271003 22:49929327-49929349 ACTGGGGGGGGCGGTTGAGCAGG No data
1185270992_1185271008 30 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271008 22:49929357-49929379 GACGACCCCGCAAGACCCTGCGG No data
1185270992_1185271002 -9 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270992 Original CRISPR CCCCGTCCCCCGTGTCCCGC GGG (reversed) Intergenic