ID: 1185270995

View in Genome Browser
Species Human (GRCh38)
Location 22:49929309-49929331
Sequence GGGACACGGGGGACGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270985_1185270995 -6 Left 1185270985 22:49929292-49929314 CCAGGAGAGGTGCCCGCGGGACA No data
Right 1185270995 22:49929309-49929331 GGGACACGGGGGACGGGGACTGG No data
1185270978_1185270995 18 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185270995 22:49929309-49929331 GGGACACGGGGGACGGGGACTGG No data
1185270982_1185270995 -1 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185270995 22:49929309-49929331 GGGACACGGGGGACGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270995 Original CRISPR GGGACACGGGGGACGGGGAC TGG Intergenic