ID: 1185271000

View in Genome Browser
Species Human (GRCh38)
Location 22:49929314-49929336
Sequence ACGGGGGACGGGGACTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270982_1185271000 4 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271000 22:49929314-49929336 ACGGGGGACGGGGACTGGGGGGG No data
1185270985_1185271000 -1 Left 1185270985 22:49929292-49929314 CCAGGAGAGGTGCCCGCGGGACA No data
Right 1185271000 22:49929314-49929336 ACGGGGGACGGGGACTGGGGGGG No data
1185270978_1185271000 23 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185271000 22:49929314-49929336 ACGGGGGACGGGGACTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185271000 Original CRISPR ACGGGGGACGGGGACTGGGG GGG Intergenic