ID: 1185271002

View in Genome Browser
Species Human (GRCh38)
Location 22:49929318-49929340
Sequence GGGACGGGGACTGGGGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270982_1185271002 8 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data
1185270994_1185271002 -10 Left 1185270994 22:49929305-49929327 CCGCGGGACACGGGGGACGGGGA No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data
1185270985_1185271002 3 Left 1185270985 22:49929292-49929314 CCAGGAGAGGTGCCCGCGGGACA No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data
1185270992_1185271002 -9 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data
1185270978_1185271002 27 Left 1185270978 22:49929268-49929290 CCTCGGAGGGGGGTCGGGGCCAG No data
Right 1185271002 22:49929318-49929340 GGGACGGGGACTGGGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185271002 Original CRISPR GGGACGGGGACTGGGGGGGG CGG Intergenic