ID: 1185271005

View in Genome Browser
Species Human (GRCh38)
Location 22:49929333-49929355
Sequence GGGGGCGGTTGAGCAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270994_1185271005 5 Left 1185270994 22:49929305-49929327 CCGCGGGACACGGGGGACGGGGA No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data
1185270992_1185271005 6 Left 1185270992 22:49929304-49929326 CCCGCGGGACACGGGGGACGGGG No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data
1185270982_1185271005 23 Left 1185270982 22:49929287-49929309 CCAGGCCAGGAGAGGTGCCCGCG No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data
1185270985_1185271005 18 Left 1185270985 22:49929292-49929314 CCAGGAGAGGTGCCCGCGGGACA No data
Right 1185271005 22:49929333-49929355 GGGGGCGGTTGAGCAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185271005 Original CRISPR GGGGGCGGTTGAGCAGGAAT GGG Intergenic