ID: 1185272368

View in Genome Browser
Species Human (GRCh38)
Location 22:49935293-49935315
Sequence CCCCAAGCCCGCTCTGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185272368_1185272386 8 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272386 22:49935324-49935346 CGGGCGGCGGGGCGCGGGGTGGG No data
1185272368_1185272379 -3 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272379 22:49935313-49935335 GGGGACCCGGGCGGGCGGCGGGG No data
1185272368_1185272385 7 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272385 22:49935323-49935345 GCGGGCGGCGGGGCGCGGGGTGG No data
1185272368_1185272383 3 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272383 22:49935319-49935341 CCGGGCGGGCGGCGGGGCGCGGG No data
1185272368_1185272377 -5 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272377 22:49935311-49935333 TGGGGGACCCGGGCGGGCGGCGG No data
1185272368_1185272391 17 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272391 22:49935333-49935355 GGGCGCGGGGTGGGGCGCGGGGG No data
1185272368_1185272387 9 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272387 22:49935325-49935347 GGGCGGCGGGGCGCGGGGTGGGG No data
1185272368_1185272388 14 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272388 22:49935330-49935352 GCGGGGCGCGGGGTGGGGCGCGG No data
1185272368_1185272376 -8 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272376 22:49935308-49935330 GCTTGGGGGACCCGGGCGGGCGG No data
1185272368_1185272390 16 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272390 22:49935332-49935354 GGGGCGCGGGGTGGGGCGCGGGG No data
1185272368_1185272389 15 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272389 22:49935331-49935353 CGGGGCGCGGGGTGGGGCGCGGG No data
1185272368_1185272378 -4 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272378 22:49935312-49935334 GGGGGACCCGGGCGGGCGGCGGG No data
1185272368_1185272392 18 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272392 22:49935334-49935356 GGCGCGGGGTGGGGCGCGGGGGG No data
1185272368_1185272381 2 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272381 22:49935318-49935340 CCCGGGCGGGCGGCGGGGCGCGG No data
1185272368_1185272393 21 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272393 22:49935337-49935359 GCGGGGTGGGGCGCGGGGGGCGG No data
1185272368_1185272384 4 Left 1185272368 22:49935293-49935315 CCCTGCGCAGAGCGGGCTTGGGG No data
Right 1185272384 22:49935320-49935342 CGGGCGGGCGGCGGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185272368 Original CRISPR CCCCAAGCCCGCTCTGCGCA GGG (reversed) Intergenic
No off target data available for this crispr