ID: 1185272692

View in Genome Browser
Species Human (GRCh38)
Location 22:49936086-49936108
Sequence GCGCTCCTCCCCCGCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185272686_1185272692 -6 Left 1185272686 22:49936069-49936091 CCCATAGGGACCCGCCCGCGCTC No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272682_1185272692 5 Left 1185272682 22:49936058-49936080 CCGTGCCCAGCCCCATAGGGACC No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272687_1185272692 -7 Left 1185272687 22:49936070-49936092 CCATAGGGACCCGCCCGCGCTCC No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272685_1185272692 -5 Left 1185272685 22:49936068-49936090 CCCCATAGGGACCCGCCCGCGCT No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272684_1185272692 -1 Left 1185272684 22:49936064-49936086 CCAGCCCCATAGGGACCCGCCCG No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272683_1185272692 0 Left 1185272683 22:49936063-49936085 CCCAGCCCCATAGGGACCCGCCC No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272681_1185272692 6 Left 1185272681 22:49936057-49936079 CCCGTGCCCAGCCCCATAGGGAC No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data
1185272678_1185272692 13 Left 1185272678 22:49936050-49936072 CCTGCAGCCCGTGCCCAGCCCCA No data
Right 1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185272692 Original CRISPR GCGCTCCTCCCCCGCCGCCC CGG Intergenic
No off target data available for this crispr