ID: 1185275132

View in Genome Browser
Species Human (GRCh38)
Location 22:49947476-49947498
Sequence CTGGTGCACCAGAAGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185275132_1185275150 30 Left 1185275132 22:49947476-49947498 CCTCGTGGCTTCTGGTGCACCAG No data
Right 1185275150 22:49947529-49947551 TTGGCTGCCTCAAAGCAAGAGGG No data
1185275132_1185275149 29 Left 1185275132 22:49947476-49947498 CCTCGTGGCTTCTGGTGCACCAG No data
Right 1185275149 22:49947528-49947550 CTTGGCTGCCTCAAAGCAAGAGG No data
1185275132_1185275141 -6 Left 1185275132 22:49947476-49947498 CCTCGTGGCTTCTGGTGCACCAG No data
Right 1185275141 22:49947493-49947515 CACCAGTGGGGTGGGGGGCCAGG No data
1185275132_1185275143 11 Left 1185275132 22:49947476-49947498 CCTCGTGGCTTCTGGTGCACCAG No data
Right 1185275143 22:49947510-49947532 GCCAGGCCTCTTTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185275132 Original CRISPR CTGGTGCACCAGAAGCCACG AGG (reversed) Intergenic
No off target data available for this crispr