ID: 1185275265

View in Genome Browser
Species Human (GRCh38)
Location 22:49947924-49947946
Sequence CCTGCTTCACAGGCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185275265_1185275276 2 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275276 22:49947949-49947971 CCAGGCACACATGGGGGCCACGG No data
1185275265_1185275279 5 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275279 22:49947952-49947974 GGCACACATGGGGGCCACGGGGG No data
1185275265_1185275281 12 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275281 22:49947959-49947981 ATGGGGGCCACGGGGGCAGGTGG No data
1185275265_1185275274 -4 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275274 22:49947943-49947965 CAGGCTCCAGGCACACATGGGGG No data
1185275265_1185275284 30 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data
1185275265_1185275273 -5 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275273 22:49947942-49947964 GCAGGCTCCAGGCACACATGGGG No data
1185275265_1185275280 9 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275280 22:49947956-49947978 CACATGGGGGCCACGGGGGCAGG No data
1185275265_1185275277 3 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275277 22:49947950-49947972 CAGGCACACATGGGGGCCACGGG No data
1185275265_1185275278 4 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275278 22:49947951-49947973 AGGCACACATGGGGGCCACGGGG No data
1185275265_1185275271 -7 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275271 22:49947940-49947962 AAGCAGGCTCCAGGCACACATGG No data
1185275265_1185275283 21 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275265_1185275272 -6 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185275265 Original CRISPR CCTGCTTCACAGGCTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr