ID: 1185275272

View in Genome Browser
Species Human (GRCh38)
Location 22:49947941-49947963
Sequence AGCAGGCTCCAGGCACACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185275259_1185275272 15 Left 1185275259 22:49947903-49947925 CCCCCATGCCTGCTGTCCTGTCC No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275257_1185275272 26 Left 1185275257 22:49947892-49947914 CCCTGGGGCAGCCCCCATGCCTG No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275263_1185275272 7 Left 1185275263 22:49947911-49947933 CCTGCTGTCCTGTCCCCACACAG No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275260_1185275272 14 Left 1185275260 22:49947904-49947926 CCCCATGCCTGCTGTCCTGTCCC No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275267_1185275272 -7 Left 1185275267 22:49947925-49947947 CCCACACAGCCTGTGAAGCAGGC No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275261_1185275272 13 Left 1185275261 22:49947905-49947927 CCCATGCCTGCTGTCCTGTCCCC No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275258_1185275272 25 Left 1185275258 22:49947893-49947915 CCTGGGGCAGCCCCCATGCCTGC No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275264_1185275272 -1 Left 1185275264 22:49947919-49947941 CCTGTCCCCACACAGCCTGTGAA No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275268_1185275272 -8 Left 1185275268 22:49947926-49947948 CCACACAGCCTGTGAAGCAGGCT No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275262_1185275272 12 Left 1185275262 22:49947906-49947928 CCATGCCTGCTGTCCTGTCCCCA No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data
1185275265_1185275272 -6 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275272 22:49947941-49947963 AGCAGGCTCCAGGCACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185275272 Original CRISPR AGCAGGCTCCAGGCACACAT GGG Intergenic
No off target data available for this crispr