ID: 1185275283

View in Genome Browser
Species Human (GRCh38)
Location 22:49947968-49947990
Sequence ACGGGGGCAGGTGGTCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185275265_1185275283 21 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275270_1185275283 11 Left 1185275270 22:49947934-49947956 CCTGTGAAGCAGGCTCCAGGCAC No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275267_1185275283 20 Left 1185275267 22:49947925-49947947 CCCACACAGCCTGTGAAGCAGGC No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275264_1185275283 26 Left 1185275264 22:49947919-49947941 CCTGTCCCCACACAGCCTGTGAA No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275275_1185275283 -4 Left 1185275275 22:49947949-49947971 CCAGGCACACATGGGGGCCACGG No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data
1185275268_1185275283 19 Left 1185275268 22:49947926-49947948 CCACACAGCCTGTGAAGCAGGCT No data
Right 1185275283 22:49947968-49947990 ACGGGGGCAGGTGGTCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185275283 Original CRISPR ACGGGGGCAGGTGGTCCAGA CGG Intergenic
No off target data available for this crispr