ID: 1185275284

View in Genome Browser
Species Human (GRCh38)
Location 22:49947977-49947999
Sequence GGTGGTCCAGACGGCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185275275_1185275284 5 Left 1185275275 22:49947949-49947971 CCAGGCACACATGGGGGCCACGG No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data
1185275270_1185275284 20 Left 1185275270 22:49947934-49947956 CCTGTGAAGCAGGCTCCAGGCAC No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data
1185275268_1185275284 28 Left 1185275268 22:49947926-49947948 CCACACAGCCTGTGAAGCAGGCT No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data
1185275267_1185275284 29 Left 1185275267 22:49947925-49947947 CCCACACAGCCTGTGAAGCAGGC No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data
1185275265_1185275284 30 Left 1185275265 22:49947924-49947946 CCCCACACAGCCTGTGAAGCAGG No data
Right 1185275284 22:49947977-49947999 GGTGGTCCAGACGGCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185275284 Original CRISPR GGTGGTCCAGACGGCTCTCA AGG Intergenic
No off target data available for this crispr