ID: 1185276792

View in Genome Browser
Species Human (GRCh38)
Location 22:49953403-49953425
Sequence CTGAACACCCTGTCCGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185276792_1185276797 -7 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276797 22:49953419-49953441 TGTTCAGGGATGAGCTGGGCAGG No data
1185276792_1185276798 -1 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276798 22:49953425-49953447 GGGATGAGCTGGGCAGGCGCTGG No data
1185276792_1185276800 1 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276800 22:49953427-49953449 GATGAGCTGGGCAGGCGCTGGGG No data
1185276792_1185276803 26 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276803 22:49953452-49953474 TCCCCATGTCAGAGGCCGCTTGG No data
1185276792_1185276801 18 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276801 22:49953444-49953466 CTGGGGCCTCCCCATGTCAGAGG No data
1185276792_1185276799 0 Left 1185276792 22:49953403-49953425 CCAAGAGCGGACAGGGTGTTCAG No data
Right 1185276799 22:49953426-49953448 GGATGAGCTGGGCAGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185276792 Original CRISPR CTGAACACCCTGTCCGCTCT TGG (reversed) Intergenic
No off target data available for this crispr