ID: 1185277260

View in Genome Browser
Species Human (GRCh38)
Location 22:49955166-49955188
Sequence GGTGGTGGTGGGGGTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277260_1185277275 30 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277275 22:49955219-49955241 GGGGACCAGAGCCAAATGGCTGG No data
1185277260_1185277271 11 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277271 22:49955200-49955222 TCCTCCTCATCAGAATGCTGGGG No data
1185277260_1185277269 9 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277260_1185277274 26 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277274 22:49955215-49955237 TGCTGGGGACCAGAGCCAAATGG No data
1185277260_1185277270 10 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277270 22:49955199-49955221 CTCCTCCTCATCAGAATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277260 Original CRISPR GGTGGTGGTGGGGGTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr