ID: 1185277261

View in Genome Browser
Species Human (GRCh38)
Location 22:49955175-49955197
Sequence CTCAGGAGAGGTGGTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277261_1185277270 1 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277270 22:49955199-49955221 CTCCTCCTCATCAGAATGCTGGG No data
1185277261_1185277271 2 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277271 22:49955200-49955222 TCCTCCTCATCAGAATGCTGGGG No data
1185277261_1185277274 17 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277274 22:49955215-49955237 TGCTGGGGACCAGAGCCAAATGG No data
1185277261_1185277269 0 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277261_1185277275 21 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277275 22:49955219-49955241 GGGGACCAGAGCCAAATGGCTGG No data
1185277261_1185277277 23 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277277 22:49955221-49955243 GGACCAGAGCCAAATGGCTGGGG No data
1185277261_1185277276 22 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277261 Original CRISPR CTCAGGAGAGGTGGTGGTGG GGG (reversed) Intergenic