ID: 1185277267

View in Genome Browser
Species Human (GRCh38)
Location 22:49955187-49955209
Sequence ATGAGGAGGAGACTCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277267_1185277275 9 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277275 22:49955219-49955241 GGGGACCAGAGCCAAATGGCTGG No data
1185277267_1185277277 11 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277277 22:49955221-49955243 GGACCAGAGCCAAATGGCTGGGG No data
1185277267_1185277271 -10 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277271 22:49955200-49955222 TCCTCCTCATCAGAATGCTGGGG No data
1185277267_1185277276 10 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277267_1185277281 26 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277267_1185277274 5 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277274 22:49955215-49955237 TGCTGGGGACCAGAGCCAAATGG No data
1185277267_1185277280 25 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277280 22:49955235-49955257 TGGCTGGGGCCTATCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277267 Original CRISPR ATGAGGAGGAGACTCAGGAG AGG (reversed) Intergenic