ID: 1185277268

View in Genome Browser
Species Human (GRCh38)
Location 22:49955192-49955214
Sequence TTCTGATGAGGAGGAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277268_1185277276 5 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277268_1185277280 20 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277280 22:49955235-49955257 TGGCTGGGGCCTATCCTGTCTGG No data
1185277268_1185277277 6 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277277 22:49955221-49955243 GGACCAGAGCCAAATGGCTGGGG No data
1185277268_1185277274 0 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277274 22:49955215-49955237 TGCTGGGGACCAGAGCCAAATGG No data
1185277268_1185277282 28 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277282 22:49955243-49955265 GCCTATCCTGTCTGGGCACCAGG No data
1185277268_1185277281 21 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277268_1185277275 4 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277275 22:49955219-49955241 GGGGACCAGAGCCAAATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277268 Original CRISPR TTCTGATGAGGAGGAGACTC AGG (reversed) Intergenic
No off target data available for this crispr