ID: 1185277269

View in Genome Browser
Species Human (GRCh38)
Location 22:49955198-49955220
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277266_1185277269 -9 Left 1185277266 22:49955184-49955206 CCACCTCTCCTGAGTCTCCTCCT No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277261_1185277269 0 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277264_1185277269 -3 Left 1185277264 22:49955178-49955200 CCACCACCACCTCTCCTGAGTCT No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277262_1185277269 -1 Left 1185277262 22:49955176-49955198 CCCCACCACCACCTCTCCTGAGT No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277256_1185277269 28 Left 1185277256 22:49955147-49955169 CCAGATCTGGCTTCTGGCTCCTG No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277260_1185277269 9 Left 1185277260 22:49955166-49955188 CCTGGGGAACCCCCACCACCACC No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277265_1185277269 -6 Left 1185277265 22:49955181-49955203 CCACCACCTCTCCTGAGTCTCCT No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data
1185277263_1185277269 -2 Left 1185277263 22:49955177-49955199 CCCACCACCACCTCTCCTGAGTC No data
Right 1185277269 22:49955198-49955220 TCTCCTCCTCATCAGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277269 Original CRISPR TCTCCTCCTCATCAGAATGC TGG Intergenic