ID: 1185277272

View in Genome Browser
Species Human (GRCh38)
Location 22:49955201-49955223
Sequence TCCCCAGCATTCTGATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277272_1185277276 -4 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277272_1185277280 11 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277280 22:49955235-49955257 TGGCTGGGGCCTATCCTGTCTGG No data
1185277272_1185277277 -3 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277277 22:49955221-49955243 GGACCAGAGCCAAATGGCTGGGG No data
1185277272_1185277282 19 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277282 22:49955243-49955265 GCCTATCCTGTCTGGGCACCAGG No data
1185277272_1185277275 -5 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277275 22:49955219-49955241 GGGGACCAGAGCCAAATGGCTGG No data
1185277272_1185277281 12 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277272_1185277285 25 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277285 22:49955249-49955271 CCTGTCTGGGCACCAGGCAGAGG No data
1185277272_1185277274 -9 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277274 22:49955215-49955237 TGCTGGGGACCAGAGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277272 Original CRISPR TCCCCAGCATTCTGATGAGG AGG (reversed) Intergenic
No off target data available for this crispr