ID: 1185277276

View in Genome Browser
Species Human (GRCh38)
Location 22:49955220-49955242
Sequence GGGACCAGAGCCAAATGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277262_1185277276 21 Left 1185277262 22:49955176-49955198 CCCCACCACCACCTCTCCTGAGT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277266_1185277276 13 Left 1185277266 22:49955184-49955206 CCACCTCTCCTGAGTCTCCTCCT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277272_1185277276 -4 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277264_1185277276 19 Left 1185277264 22:49955178-49955200 CCACCACCACCTCTCCTGAGTCT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277273_1185277276 -7 Left 1185277273 22:49955204-49955226 CCTCATCAGAATGCTGGGGACCA No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277261_1185277276 22 Left 1185277261 22:49955175-49955197 CCCCCACCACCACCTCTCCTGAG No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277263_1185277276 20 Left 1185277263 22:49955177-49955199 CCCACCACCACCTCTCCTGAGTC No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277267_1185277276 10 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277265_1185277276 16 Left 1185277265 22:49955181-49955203 CCACCACCTCTCCTGAGTCTCCT No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data
1185277268_1185277276 5 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277276 22:49955220-49955242 GGGACCAGAGCCAAATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277276 Original CRISPR GGGACCAGAGCCAAATGGCT GGG Intergenic
No off target data available for this crispr