ID: 1185277281

View in Genome Browser
Species Human (GRCh38)
Location 22:49955236-49955258
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185277273_1185277281 9 Left 1185277273 22:49955204-49955226 CCTCATCAGAATGCTGGGGACCA No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277268_1185277281 21 Left 1185277268 22:49955192-49955214 CCTGAGTCTCCTCCTCATCAGAA No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277266_1185277281 29 Left 1185277266 22:49955184-49955206 CCACCTCTCCTGAGTCTCCTCCT No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277267_1185277281 26 Left 1185277267 22:49955187-49955209 CCTCTCCTGAGTCTCCTCCTCAT No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data
1185277272_1185277281 12 Left 1185277272 22:49955201-49955223 CCTCCTCATCAGAATGCTGGGGA No data
Right 1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185277281 Original CRISPR GGCTGGGGCCTATCCTGTCT GGG Intergenic