ID: 1185278624

View in Genome Browser
Species Human (GRCh38)
Location 22:49960659-49960681
Sequence CGCCGCCGCCTCGCGGGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 1, 2: 10, 3: 64, 4: 463}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185278611_1185278624 6 Left 1185278611 22:49960630-49960652 CCCCGCCGTCTCCCCAGCTAGCG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278610_1185278624 14 Left 1185278610 22:49960622-49960644 CCAAGCTGCCCCGCCGTCTCCCC 0: 1
1: 0
2: 2
3: 30
4: 386
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278617_1185278624 -6 Left 1185278617 22:49960642-49960664 CCCAGCTAGCGCCCGGCCGCCGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278612_1185278624 5 Left 1185278612 22:49960631-49960653 CCCGCCGTCTCCCCAGCTAGCGC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278616_1185278624 -5 Left 1185278616 22:49960641-49960663 CCCCAGCTAGCGCCCGGCCGCCG 0: 1
1: 1
2: 0
3: 11
4: 108
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278613_1185278624 4 Left 1185278613 22:49960632-49960654 CCGCCGTCTCCCCAGCTAGCGCC 0: 1
1: 0
2: 0
3: 19
4: 233
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278614_1185278624 1 Left 1185278614 22:49960635-49960657 CCGTCTCCCCAGCTAGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278618_1185278624 -7 Left 1185278618 22:49960643-49960665 CCAGCTAGCGCCCGGCCGCCGCC 0: 1
1: 0
2: 1
3: 25
4: 246
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278609_1185278624 27 Left 1185278609 22:49960609-49960631 CCGAAGACAGGCGCCAAGCTGCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463
1185278608_1185278624 28 Left 1185278608 22:49960608-49960630 CCCGAAGACAGGCGCCAAGCTGC 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG 0: 1
1: 1
2: 10
3: 64
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185278624 Original CRISPR CGCCGCCGCCTCGCGGGCCC CGG Exonic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900702660 1:4057941-4057963 CGCTGCAGCCTGGAGGGCCCCGG + Intergenic
900987722 1:6082951-6082973 CGCAGCTGCTTCGTGGGCCCTGG + Intronic
901433998 1:9235085-9235107 CCCCGCCGCCGCCCCGGCCCCGG + Intronic
901489286 1:9588656-9588678 CGCCGCCGCCCCGCCCACCCGGG + Intergenic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901512972 1:9727061-9727083 AGCCGCCTCCTCTTGGGCCCAGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902067472 1:13700231-13700253 CGCCGCTGTTTCGCCGGCCCCGG - Intronic
902286111 1:15409796-15409818 CGCGCACGCCGCGCGGGCCCGGG + Intergenic
902323640 1:15684487-15684509 CGCCGCCGCTTCCCGCGCCGGGG - Exonic
902451517 1:16499388-16499410 CGCCGCAGACCCGCGGCCCCTGG - Intergenic
903069130 1:20717907-20717929 CGCCGCTTCCTCCCGCGCCCGGG + Exonic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903652497 1:24930310-24930332 CAGCCCCGCCCCGCGGGCCCCGG - Intronic
903750580 1:25618049-25618071 GGCCCCCGCCGCGCCGGCCCCGG + Exonic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
903998316 1:27322235-27322257 CGCCGCCGCCACCCCCGCCCAGG + Exonic
904199784 1:28812264-28812286 CGCCGCCGGCTGCCGCGCCCCGG - Exonic
904256905 1:29259992-29260014 CGCCCGCGCCGCGCGGGGCCTGG - Exonic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904652208 1:32014108-32014130 CGCCGCTGCCTCACCGGTCCCGG + Exonic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
905037980 1:34929781-34929803 CCCCGCCCCCGCGCGGACCCAGG + Intergenic
905449113 1:38046029-38046051 AGCCGCCGCCGCCCGCGCCCGGG + Exonic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905803793 1:40861948-40861970 CGCCGCCGCCCCGCCAACCCGGG - Exonic
906532757 1:46532984-46533006 CGCCGCCCCCTAGCGGACCAGGG - Intergenic
906532820 1:46533209-46533231 CGCGGCCGCCACCCTGGCCCGGG + Intergenic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
906719770 1:47996794-47996816 CCCCCGCGCCCCGCGGGCCCTGG - Exonic
906917191 1:50023998-50024020 CGCCCCCGCGGCGCGAGCCCGGG + Intergenic
907012686 1:50978096-50978118 CGCCGGCGCCTCCCGGCCGCCGG + Intergenic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
910788057 1:91021858-91021880 GGCCTCCGGCTCTCGGGCCCGGG - Intronic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
913323222 1:117605424-117605446 CGCCGGCGGCTCTCTGGCCCCGG - Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
915530864 1:156501248-156501270 CGGCACCTCCTCGCGGCCCCGGG + Intergenic
916430538 1:164723635-164723657 CTCTGCCGCCTGGCTGGCCCAGG - Intronic
920385747 1:205569318-205569340 CGCCCCCGCCCCGCGGCCCCCGG + Intronic
921189766 1:212699386-212699408 CGCCGACGCCTGGCTGGGCCGGG - Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922200031 1:223393675-223393697 CCCCGCGGCCTCGCAGGCGCGGG + Exonic
922496502 1:226062231-226062253 GGCTGCCCCCGCGCGGGCCCCGG - Intronic
923171638 1:231422210-231422232 CGCCGCCGCCTCAGCGTCCCGGG + Exonic
924527427 1:244864392-244864414 CGCAGCCGCCGCCCGGGCCGAGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064443186 10:15371315-15371337 CGCCGCCGCTGCCCGCGCCCAGG + Intergenic
1066022772 10:31319582-31319604 CGCCGCCGCATCCCCGGCGCAGG + Intronic
1066672739 10:37857610-37857632 CGCCTCCTCCCCGCGGGCTCAGG + Exonic
1067416401 10:46106396-46106418 CGCCGCGGCCCCCAGGGCCCAGG + Intergenic
1067572925 10:47384659-47384681 CGCCGAGGCCCCGCGGGCCCAGG - Intergenic
1067711884 10:48656425-48656447 CGGCGCCCCCTGGCGGGCCTCGG + Intergenic
1069024078 10:63521439-63521461 CGCCGGCTCCTCGCGCTCCCCGG - Exonic
1069024213 10:63521935-63521957 CGGCACCGCCCTGCGGGCCCGGG + Intronic
1069564113 10:69451740-69451762 GGCCGCCCCCTCACTGGCCCGGG + Intronic
1069837658 10:71319385-71319407 CGCAGCCGCCCCCAGGGCCCGGG - Intronic
1070329131 10:75405490-75405512 CTGCCCCGCCTCGCGGTCCCTGG + Intergenic
1070610038 10:77926697-77926719 AGCGGCCGCCTCCCGGGCTCCGG + Intergenic
1070954194 10:80454053-80454075 CGACCCGGCCTCGCGGTCCCCGG + Intergenic
1071527461 10:86366639-86366661 CGCCCCCGCCGCGCCGGCCTGGG - Intergenic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072553993 10:96500702-96500724 AGCCTCCGCCTCCCGGGCTCAGG - Intronic
1072555918 10:96513614-96513636 TGCCGCTGCCTCGCGGCGCCGGG - Exonic
1073196181 10:101694292-101694314 CGCCGCGGCCTGGTCGGCCCAGG - Intronic
1075616005 10:123891462-123891484 CGCCGCTGCCTGCGGGGCCCGGG - Exonic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1076035631 10:127196590-127196612 CACCTCCGCCCCGCGGGGCCCGG - Intronic
1076582481 10:131520887-131520909 CGCCCCCGCCCCACAGGCCCGGG + Intergenic
1077053239 11:576947-576969 CGCCGCGTCCTCGCAAGCCCAGG - Intronic
1077105954 11:842732-842754 TGCCGCGGCCGCGCGGGCCCGGG - Intergenic
1077204936 11:1337494-1337516 CGCCCCCGCCTCGGGCCCCCGGG - Intergenic
1077249997 11:1556824-1556846 CGCCGTCGCCCGACGGGCCCTGG - Exonic
1077544902 11:3165057-3165079 CGCCGCAGCCCCGCGGACCCTGG - Intronic
1077582077 11:3423110-3423132 CGGCCCCGCCTCCCGGACCCTGG - Intergenic
1078316059 11:10294118-10294140 CGCCGCCGCCCACCCGGCCCGGG + Exonic
1078594675 11:12675278-12675300 CGCCGCCGCCCCCCGGCGCCGGG + Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1078771777 11:14358650-14358672 CAGAGGCGCCTCGCGGGCCCGGG - Intronic
1079451204 11:20601262-20601284 CGCCGCCGCCACGTGTGCCCAGG + Exonic
1079459961 11:20670235-20670257 CACCGCGCCCTCCCGGGCCCCGG - Intronic
1079689412 11:23403546-23403568 CGCCGCCGCGGGACGGGCCCAGG + Intergenic
1080012322 11:27471997-27472019 CCCCGCCGCCGCCCGGGCCTGGG - Intronic
1081488318 11:43548091-43548113 CCCCGCCCCCTCACGTGCCCTGG + Intergenic
1081705682 11:45180930-45180952 CGCCGCCGGCTTTGGGGCCCCGG + Intronic
1081873115 11:46392062-46392084 CGGCGCCCCCTCGCGGGCTGGGG + Intergenic
1083365265 11:62138414-62138436 CGCCTCCACCTCTTGGGCCCAGG - Intronic
1083571296 11:63763453-63763475 CGCCGCCGTCACGCGGCGCCGGG + Exonic
1083578994 11:63813293-63813315 TCCCGCCGCCTCCCGGGTCCAGG + Intergenic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083657029 11:64234676-64234698 CGCGGCCCCCTCCCGAGCCCTGG - Exonic
1083670985 11:64299852-64299874 CTCCGCCTCCTCCCTGGCCCCGG + Exonic
1083710163 11:64543015-64543037 CGCTGCCGCCTCCCCGGGCCCGG - Intergenic
1084068468 11:66718911-66718933 CTCCGCCGCCCCGCAGGGCCTGG - Intronic
1084084590 11:66849195-66849217 CCCCACCGCCTGGCTGGCCCTGG + Intronic
1084295985 11:68213616-68213638 CGCCGCCGCGTCGCCGCCCCCGG + Intronic
1084833438 11:71786913-71786935 CGGCCCCGCCTCCCGGACCCTGG + Intergenic
1084893763 11:72250605-72250627 CGCCGCTGCCTCTTGGGCCCTGG - Intergenic
1084913328 11:72408868-72408890 GCCCGCCGCCTAGCTGGCCCAGG - Intronic
1085318786 11:75562064-75562086 TGCCGGCGCCTCCCGGCCCCTGG - Intronic
1085332919 11:75668079-75668101 CGCCGCCGGCTCGCGCTCGCCGG + Exonic
1085353427 11:75815379-75815401 CCCCGCCGCTTGGCGGCCCCTGG + Exonic
1085561098 11:77473670-77473692 CGCCGCCGCCGCGCTGCCCGTGG + Exonic
1086384423 11:86292659-86292681 GGCCTCCGCCTCCTGGGCCCAGG + Intergenic
1087138112 11:94740505-94740527 CGCCGCCGCCGCGCGCCCTCGGG + Intronic
1087241826 11:95789544-95789566 AGCCGCCGCCGCCCGGGCCGCGG + Exonic
1088663790 11:112074332-112074354 CGCCGCAGCCTCGCGTGGCGGGG - Exonic
1089046325 11:115504320-115504342 CGGCGGCGCCTCCCGGGCTCCGG - Exonic
1089458973 11:118641694-118641716 GGCCTCCGCCTCCCGGGACCTGG + Intronic
1089713709 11:120336451-120336473 CGCCTCCGCCTCCCGGACCAGGG + Intergenic
1090238287 11:125165160-125165182 CGCCGCCGCCTCGCCGCGCTTGG + Intronic
1090344995 11:126062654-126062676 AGCCGCCGCCGCGCGCGCGCGGG - Intronic
1091381884 12:67134-67156 TGCCGCCGCCGCCAGGGCCCAGG + Exonic
1091718416 12:2795540-2795562 CTCCGCCGCCCCGCGCGCGCCGG - Intronic
1091718551 12:2795937-2795959 CTCCGCCGCCTCCCGGAGCCAGG + Intronic
1092196755 12:6554524-6554546 CCCCGCGGCCTCGCGGTCCTAGG + Intronic
1092409682 12:8243558-8243580 CGGCACCGCCTCCCGGACCCTGG - Intergenic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1094719941 12:33052925-33052947 CGCCGCCGCCGGGCAGGCCGGGG + Intergenic
1096106334 12:48998618-48998640 AGCCGCCGCCCCGCCGGCCCTGG - Exonic
1096675481 12:53223485-53223507 AGCCGCCGCCGCCAGGGCCCAGG - Intronic
1096738862 12:53677180-53677202 CGCCGCCCCCTCCCGGCTCCCGG + Intronic
1096981077 12:55728561-55728583 CCCCGCCGCCTCTGGGGCCCAGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097057391 12:56258176-56258198 CGCTGCCGTCACGCGAGCCCGGG - Intronic
1097155080 12:57006471-57006493 CGCCGCCTCCTCGTCGGGCCGGG - Intergenic
1098288503 12:68933171-68933193 CGCGGCCGCCCGGCGGGGCCGGG + Exonic
1099315523 12:81078237-81078259 CGAGACCGCCCCGCGGGCCCGGG - Exonic
1101466806 12:104957981-104958003 CGCCGCCGGGTCCCGAGCCCAGG + Intronic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103567273 12:121823037-121823059 GCCCGCCGTCTTGCGGGCCCAGG + Exonic
1104448837 12:128853526-128853548 CGCCGCCGCCGACCAGGCCCCGG - Exonic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1104932604 12:132347719-132347741 AGCCTCCGCCTCCCTGGCCCCGG - Intergenic
1105725735 13:23160413-23160435 CCCCGCCTCCCCGCGCGCCCCGG + Intergenic
1106226485 13:27790552-27790574 GGCAGCCGCCCCGCGTGCCCGGG - Intergenic
1106568508 13:30906688-30906710 CGCCGCCGGCTCCCCGGGCCTGG - Exonic
1107534149 13:41311601-41311623 CGCTGCCGCCCCCCGGTCCCCGG + Intronic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1111672458 13:91348052-91348074 CGCCGCCGCCACGCTGCCCCGGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112271896 13:97976463-97976485 CGCCGGCGCCTCACTGGCCTTGG - Intronic
1112580835 13:100675021-100675043 CGCCGCCGACTAGCGCCCCCTGG - Intronic
1112652699 13:101416276-101416298 CGCCGCAGCCTCCCGGGCACCGG + Intronic
1113472678 13:110558007-110558029 GGCCGCTGCCCCGCAGGCCCTGG - Intronic
1113841702 13:113364474-113364496 CGCCGCGGCCTCGGAAGCCCCGG - Intergenic
1113962022 13:114131580-114131602 AACCGCAGCCTCGCAGGCCCTGG + Intronic
1114483999 14:23052441-23052463 TGCTGCCGCCTTGTGGGCCCTGG + Intronic
1115474482 14:33800380-33800402 CGCCGCCGCCCTGCGGGGACGGG - Exonic
1117029290 14:51652076-51652098 CGCCGCCGCCCCGCCGGCAGGGG - Intronic
1117842052 14:59870451-59870473 CGACGCCGCTTCCCGGGCCCTGG + Exonic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118220885 14:63853507-63853529 GGCCGCCCCCTCCCGGGCCCAGG + Intronic
1118836820 14:69484082-69484104 CGCCGCCGCCTAGCGCGCATCGG - Intergenic
1118971543 14:70642057-70642079 CGCCGCCGCCGCGCCTTCCCGGG - Exonic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119286385 14:73458345-73458367 CGCCGCCTCCGCCCTGGCCCCGG + Intronic
1119410313 14:74426159-74426181 CGCCGCCGCCGCGCAGCCCTCGG + Intergenic
1119793637 14:77376764-77376786 CGCTGCCACCACCCGGGCCCTGG - Intronic
1121616953 14:95319811-95319833 CGCCCGCGCCGCGCTGGCCCGGG - Exonic
1121886386 14:97546713-97546735 CCCCACCGCCTGGCGGGGCCTGG - Intergenic
1122221327 14:100240342-100240364 CGCCGCGGCCTCGCGGGCCAGGG + Intronic
1122418367 14:101560953-101560975 GGCCGCCGCTTCGGTGGCCCCGG - Intergenic
1122775993 14:104117172-104117194 CGCCGCGTCCTCGCTGGCCCCGG - Intergenic
1123054069 14:105561011-105561033 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1123078654 14:105681428-105681450 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1202898488 14_GL000194v1_random:23085-23107 CGCCGCCGAGAAGCGGGCCCTGG - Intergenic
1123630788 15:22258303-22258325 GGCCTCCCCCGCGCGGGCCCCGG + Intergenic
1124629368 15:31327987-31328009 CGCGGTCGCCTGGCGGGCGCCGG - Intronic
1124848083 15:33311027-33311049 CGCCGACGCCTCGGGAGCCATGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126137195 15:45403187-45403209 CGCGCCCGCCTCGCGCGCCACGG - Exonic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128075716 15:64824136-64824158 CGCGGCCGCCCCGCGGGCCCTGG + Exonic
1128124721 15:65184457-65184479 CGCCGCTGTCCTGCGGGCCCCGG + Intronic
1128156681 15:65395894-65395916 CGCTGCCGCGTCGCTGGCCGTGG - Exonic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1128274584 15:66342106-66342128 TGCCTCCGCCTCCCGGGTCCCGG - Intronic
1128767256 15:70258818-70258840 CGCCCCCGCCTCACCAGCCCTGG + Intergenic
1129082316 15:73052187-73052209 GGCTGCCGCCTCTCGGGCCGTGG - Intronic
1129446902 15:75625280-75625302 CGCCCCCGCCTCGCGTCCCCTGG + Intronic
1129450296 15:75647740-75647762 CTCCGCCCTCCCGCGGGCCCGGG - Intronic
1129814643 15:78540752-78540774 GCCCGCCCCCTCGCGGGCCCCGG - Intronic
1130531234 15:84748830-84748852 GACCGCCGCCTGGCGGGCCCGGG + Intronic
1132186758 15:99807164-99807186 CCCCGCCCCGTCGCGGTCCCGGG - Intergenic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132398265 15:101489635-101489657 CGCCGCCTGCGCCCGGGCCCCGG - Exonic
1132428929 15:101745547-101745569 CCCCGCCCCGTCGCGGTCCCGGG + Intronic
1132759026 16:1500038-1500060 GGCCGCCGCCTGGCCAGCCCGGG - Intronic
1132771549 16:1566541-1566563 AGCCTCCGCCTCCCGGGCTCAGG + Intronic
1132831353 16:1929900-1929922 CGAGGCGGCCTCCCGGGCCCGGG - Intergenic
1133011048 16:2912035-2912057 CGCCGCCGCCACCCCGACCCGGG - Exonic
1133188336 16:4116012-4116034 CGCCCCCGGCTCGCGCTCCCCGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133350655 16:5098339-5098361 CGGCCCCGCCTCCCGGACCCTGG - Intergenic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1137426425 16:48384947-48384969 CGCCGCCACCCCGCCGGGCCCGG + Intronic
1137618010 16:49858225-49858247 CGCCGCGGCCCGGCCGGCCCCGG - Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139545632 16:67648353-67648375 AGCCGCCTCCTTGCGGCCCCAGG + Intronic
1139890626 16:70251393-70251415 CACCGCCGCCGCGCTCGCCCTGG - Exonic
1139903569 16:70346994-70347016 GGCCACCGACTCGTGGGCCCTGG + Exonic
1141418922 16:83899200-83899222 CCCCGCGGCCGCCCGGGCCCCGG + Exonic
1141972257 16:87492270-87492292 GGCCGCCCCCGCGCGGTCCCCGG - Intergenic
1142195468 16:88737425-88737447 TGCCGCCCCCTCGGGGGCCCAGG - Intronic
1142350100 16:89575835-89575857 CGGCGCCGACTCGCGGGCAGCGG + Exonic
1142808698 17:2385325-2385347 CCCGGCCCCCTCGCCGGCCCAGG + Exonic
1142876294 17:2853647-2853669 CGGCCCCGCCTCCCGCGCCCCGG - Intronic
1143063359 17:4222216-4222238 CCCCGCCGCCCCGCGGACCCCGG + Intronic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1146356911 17:32142351-32142373 GGCCGCCGCAGCGCAGGCCCAGG - Exonic
1146371088 17:32265997-32266019 CGCCGCCTCCTCGCGACCCCGGG - Intergenic
1147161786 17:38572833-38572855 GGCCGCCGCCGTGCCGGCCCGGG + Intronic
1147617091 17:41836050-41836072 AGCCGCCCCCTCGCGCACCCCGG - Intronic
1147933059 17:43994921-43994943 CGCCCCAGCCTCGCCGCCCCGGG + Intronic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150004612 17:61462284-61462306 AGCCGCCTGCTCGCCGGCCCGGG - Intronic
1150108564 17:62479021-62479043 CCCCGCGGCCGCCCGGGCCCGGG + Exonic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1150217205 17:63477351-63477373 CCCCGCCCCCGCCCGGGCCCGGG - Intergenic
1150624819 17:66835082-66835104 CGCCGCCGCAGCTCGCGCCCCGG - Intergenic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1151866432 17:76806256-76806278 CCCCGCCGCCCCGCCGGCACGGG + Intergenic
1151938877 17:77280964-77280986 CGCCGCCGCCTCGCCCGGCGGGG + Intronic
1151961841 17:77409705-77409727 ACCCGCCGCCTCCCAGGCCCGGG + Intronic
1152352502 17:79791456-79791478 CCCCGCAGCCTCTCCGGCCCAGG - Intergenic
1152468051 17:80476705-80476727 CCCCGCCGCGCCGCGGGCCCGGG - Intronic
1152565465 17:81098267-81098289 GGCCGCTGCCTCCCAGGCCCCGG - Intronic
1152571261 17:81122213-81122235 CACCGCCGCCTCGCTGGCCATGG - Exonic
1152628127 17:81397582-81397604 GGCCGGCGCCTCCCGAGCCCCGG - Intronic
1152641946 17:81452894-81452916 CTCCCCAGCCTCGAGGGCCCAGG - Intronic
1152711134 17:81871033-81871055 CCCCGCCGCCCCTCCGGCCCGGG + Intronic
1152714392 17:81891490-81891512 CCCGGCCGCCTCGCTGGCTCCGG + Exonic
1153565651 18:6414891-6414913 CGCCGCTGCCCCGCGGTGCCCGG + Intronic
1153636612 18:7117998-7118020 CGCGGCCGCCTCCCCGGCTCCGG + Intergenic
1154241552 18:12657942-12657964 CGCCGCCGCCTCACCATCCCCGG + Exonic
1155152684 18:23135476-23135498 GGCCGCTGGCTCGCGGGCTCCGG - Intronic
1155963940 18:32018908-32018930 CTCTGCCACCGCGCGGGCCCTGG + Exonic
1156338130 18:36187538-36187560 CTCCGCCGCCGCGCCGGCCATGG - Exonic
1157867118 18:51197006-51197028 CTCGGCCGCCTCCGGGGCCCCGG + Exonic
1157867329 18:51197633-51197655 CGCCGCCGCCGCGCGCGCCGGGG - Intronic
1158931084 18:62325463-62325485 CGACGCCTCCTCGGGAGCCCCGG + Intronic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1158976218 18:62714114-62714136 AACCTCCGCCTCTCGGGCCCAGG - Intergenic
1160870444 19:1275418-1275440 CGCCTCCGCCTGGTGAGCCCCGG - Exonic
1160909481 19:1468128-1468150 CGCGTCCGCCTCCTGGGCCCGGG - Exonic
1160923113 19:1529743-1529765 CGCCGGCTCCCCTCGGGCCCTGG - Exonic
1160930515 19:1567789-1567811 CGCCGCCGCTGCGCCGTCCCCGG + Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1160967597 19:1753472-1753494 GGCCGCCGGCGCCCGGGCCCGGG - Exonic
1161215819 19:3094597-3094619 CGCCGCCGCCCCCCGGCCCCCGG - Exonic
1161346408 19:3770760-3770782 CTCCCCCGCCTCCTGGGCCCGGG - Exonic
1161400673 19:4065397-4065419 CCCCGCCGCCTCGCCCGCGCGGG + Intronic
1161550362 19:4909333-4909355 CGCCTCCGCCTAGTGGGCCACGG - Intronic
1161644891 19:5447151-5447173 TGCCCCAGCCTGGCGGGCCCGGG - Intergenic
1161672781 19:5623450-5623472 CGACGGTGGCTCGCGGGCCCTGG + Intronic
1162238165 19:9324440-9324462 CCCCGCCTCCTCCCGGGCCGAGG - Intronic
1162341827 19:10095993-10096015 CGCCCGCGCCTCCCGGGCACAGG + Exonic
1162535847 19:11262487-11262509 CGCCGCCGCCTCCCGGTTCTGGG + Intergenic
1162959491 19:14117616-14117638 CGCCGCCGCCCAGCGCGCTCCGG - Exonic
1163026831 19:14517754-14517776 AGGCGCCGCCCCGCGGACCCCGG + Intronic
1163149219 19:15401245-15401267 CGCCCCCACCTCGCATGCCCTGG + Exonic
1163607100 19:18281492-18281514 CTCCCCCGCCGCGCCGGCCCGGG + Exonic
1163716804 19:18877671-18877693 AACCGCCGCCTCCCAGGCCCAGG - Intronic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1165939147 19:39406716-39406738 CGGCGCAGCCTGGCTGGCCCTGG - Intergenic
1166219130 19:41353898-41353920 CGCCGCCGCCCTTCGCGCCCTGG - Exonic
1166677277 19:44747855-44747877 CCCCGGTGCCCCGCGGGCCCCGG + Intronic
1166706094 19:44908841-44908863 CTCGGCGCCCTCGCGGGCCCCGG - Exonic
1167258127 19:48443092-48443114 CGCGGCCACCGCGCGGGCGCCGG - Exonic
1167578467 19:50328897-50328919 CCCCGGCACCCCGCGGGCCCGGG - Exonic
1167696628 19:51019085-51019107 CTCCGCCGCCTCTGGCGCCCGGG - Exonic
1168119476 19:54243545-54243567 AGCCTCCGCCTCCCGGGCCCAGG - Intronic
1168641469 19:58034299-58034321 GCCCGCCCCCTCCCGGGCCCGGG - Intronic
924987735 2:287614-287636 CGCCGCCTCCGCGCGGCCCAGGG + Exonic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927714283 2:25342106-25342128 CCCCGCGGCCGCGCTGGCCCCGG + Intronic
927809328 2:26173011-26173033 CGCCCCCTCCTCCCGGACCCCGG - Intergenic
929760523 2:44802623-44802645 CTCCGCAGACTCGCGGGCCGGGG + Intergenic
930011524 2:46941406-46941428 CCCCGCTGCCGCCCGGGCCCCGG + Exonic
931052412 2:58428837-58428859 CGCCACCGCCTCCGGGACCCAGG + Intergenic
931517776 2:63059785-63059807 CGCCGCGGCCCGGCAGGCCCTGG - Intergenic
932496584 2:72148624-72148646 CGCCGCCCCATCGCCCGCCCGGG - Intergenic
932699676 2:73984591-73984613 CCACCCCGCCTCGCCGGCCCCGG + Intergenic
932780605 2:74556332-74556354 CGCCGCTGCCCCTCAGGCCCTGG + Exonic
933772606 2:85753831-85753853 CGCCACCGCCTCCCCAGCCCGGG - Intronic
934113724 2:88765243-88765265 TGCCGCTGCCCCGCTGGCCCCGG - Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
934661383 2:96145398-96145420 CGCCACCGCCACGAGAGCCCGGG - Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
936518807 2:113199018-113199040 CTCCGCCGCTTTCCGGGCCCGGG - Intronic
936531148 2:113277860-113277882 CGCTGCCGGCTCCCGGGCCCGGG + Intronic
937083462 2:119156548-119156570 TGCCGCCGCCTCAAGGGCTCGGG + Exonic
937367753 2:121276549-121276571 AGCCTCTGCCTCGCGGGCTCAGG - Intronic
938073043 2:128318419-128318441 CGCGGCCGCCGGGCGCGCCCAGG + Exonic
938727285 2:134120123-134120145 GGCCGCCGCCGAGCGGGCCGCGG - Intronic
941021030 2:160407917-160407939 CGCTGCCGCCTCCCCGCCCCCGG - Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
943060675 2:183038571-183038593 CGCCGCCGCCGCTCTGGCCCTGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946185561 2:217978736-217978758 GGCCGCGGGCTGGCGGGCCCGGG - Intronic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947353632 2:229271304-229271326 CGCCGCCGCCGCGCGCTCGCCGG - Intergenic
947399288 2:229715135-229715157 CGCCTCCGCCAGGCGGACCCGGG + Intergenic
947619765 2:231582275-231582297 AGCCTCCGCCTCCCCGGCCCAGG - Intergenic
947632304 2:231662146-231662168 CGTGGCCGCCTCGCGGGCCGGGG - Intergenic
947815189 2:233032105-233032127 CGCCGCCCCCTCGCTGCCTCAGG + Intergenic
947919015 2:233853960-233853982 CGCCGCCTCCTCCCGGGTCTGGG - Intronic
948116030 2:235494627-235494649 CGCCGCCGCCCCGCGCCCCGGGG - Exonic
948117241 2:235502392-235502414 GGCAGCCCCCTCTCGGGCCCTGG - Intronic
948463136 2:238139713-238139735 CGCGGCCGCCTCTCCTGCCCGGG + Intronic
948487206 2:238288582-238288604 CGCCGCCGGCGCGCGGGCCTCGG - Exonic
1169065636 20:2692986-2693008 CGCCAGCGCCCCGCGTGCCCCGG - Exonic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1169557667 20:6767865-6767887 CGCGGGTGCCTCGCGGTCCCCGG - Exonic
1170756838 20:19212571-19212593 CGCCGCCGCCTCCCGGCGCTCGG - Intergenic
1170890079 20:20368840-20368862 TGCCGCCGCCCTGCGGCCCCCGG + Exonic
1171972480 20:31573018-31573040 GGCCTCCGCCTCCCGCGCCCTGG - Intronic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1173548169 20:43914873-43914895 CGCCGCCGCCGCGCCCGCCATGG + Exonic
1174380659 20:50153530-50153552 CGCAGCCAGCTCGCGGGCCCCGG + Exonic
1174607032 20:51768451-51768473 CGCCGGCGCCGCGCCGCCCCGGG + Exonic
1175394631 20:58650216-58650238 CGGCGGCGCCTTCCGGGCCCCGG - Intergenic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175999275 20:62824854-62824876 CGCTGCCGTGTGGCGGGCCCTGG + Intronic
1176135607 20:63520867-63520889 CGGCGACCCCTCGCGGGCCTCGG - Exonic
1176136533 20:63524799-63524821 AGCCTCCGCCTCCCGGGCTCAGG - Intergenic
1176283318 20:64327699-64327721 TGCCGCCGCCGCCAGGGCCCAGG - Intergenic
1176382006 21:6118349-6118371 CGCGGCTGCCTGGCAGGCCCGGG - Exonic
1176618170 21:9039075-9039097 CGCCGCCGAGAAGCGGGCCCTGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1178992781 21:37368139-37368161 AGCCGCTGCCTCGGCGGCCCTGG + Intronic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1179605634 21:42513789-42513811 CGCCGGCGCCCCGCGGGCCAGGG + Intronic
1179741466 21:43419890-43419912 CGCGGCTGCCTGGCAGGCCCGGG + Exonic
1179810437 21:43865847-43865869 GGCCTCCTCCTCGCGCGCCCAGG + Intronic
1180101839 21:45591026-45591048 AGCCGCCGCCTCGCCCGCCGTGG - Intergenic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181085562 22:20437905-20437927 CGCTGCCGCCTGGCCGGCCGCGG - Intronic
1181147397 22:20858692-20858714 CGCCTCCGCCTCCCCGGGCCGGG + Exonic
1181283448 22:21735922-21735944 CGCCCCCGCCCCGCGCGCTCCGG + Intergenic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181592563 22:23894321-23894343 AGCCGCAGCCTCGCGGGGGCGGG + Exonic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184408392 22:44313025-44313047 GGCCGCCACCTCCCAGGCCCAGG + Intergenic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1184680712 22:46071122-46071144 CGCCTCGGCCGCGCGGGCCCCGG + Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185398526 22:50604480-50604502 CGCGGCCGCCTCGGGGTCCTGGG - Exonic
949105768 3:198071-198093 AGCAGCAGCCGCGCGGGCCCAGG + Intronic
950487711 3:13282765-13282787 CGCCGCCCCGACCCGGGCCCCGG - Intergenic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
951981870 3:28575564-28575586 CCCCGCCTCCGCGCTGGCCCTGG - Intergenic
954382583 3:50227488-50227510 CGGCGCCTCCTGGCGGGCCTGGG - Intronic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
955291079 3:57692926-57692948 GGCCGGCGCCTCGCGGCCCTCGG + Exonic
955368785 3:58333129-58333151 CGCAGCCCCCTCGCGGCCCGGGG - Intronic
955911535 3:63863787-63863809 CGCCGCCGCCGCGCACGCCATGG - Exonic
956675029 3:71725314-71725336 CCCCGGCGGCTCCCGGGCCCCGG + Exonic
956678107 3:71753950-71753972 CTCCGCCGCTCCGCCGGCCCTGG - Intronic
959357776 3:105354104-105354126 GACCTCCCCCTCGCGGGCCCTGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
961081528 3:124032940-124032962 CCCCGCCCCCTCCCTGGCCCGGG + Intergenic
961299915 3:125915988-125916010 CGGCCCCGCCTCCCGGACCCTGG + Intergenic
961389209 3:126542440-126542462 AGCCGCCGCCTCCCGCGACCTGG + Exonic
961545424 3:127629575-127629597 GGCTGCTGCCTCGCGGGCCGGGG + Intronic
961574450 3:127823216-127823238 CCCCGCCGCCGAGCCGGCCCAGG - Intronic
961674271 3:128555380-128555402 CGCGGCCGCCGCGCGCACCCTGG - Intergenic
962301848 3:134250495-134250517 CGCCCCCGCCCCGCGGCCCCCGG - Exonic
963081846 3:141402241-141402263 ACCCGCAGCCCCGCGGGCCCGGG - Intronic
964771293 3:160226127-160226149 GCCCGCCGCCTCCCCGGCCCCGG - Exonic
965590583 3:170357471-170357493 CGCCGCCACTTCGCGGCTCCCGG - Intergenic
967685281 3:192409913-192409935 CGCCGCCGCCTCCCCAGGCCCGG + Intronic
967914134 3:194565495-194565517 AGCCTCCACCTCTCGGGCCCAGG - Intergenic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968258189 3:197297996-197298018 CGCCGCCTCCTCGCTCGCCGCGG + Intronic
968583612 4:1406012-1406034 CGCCGCGCCCTCGCCGGCGCCGG - Exonic
969756268 4:9152660-9152682 CGGCCCCGCCTCCCGGACCCTGG + Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970574554 4:17414423-17414445 AGCCGCCTCCCCGCGGGCCAGGG - Intergenic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
978532558 4:109729873-109729895 CGCCGCTGCCTAGCGCGTCCTGG - Exonic
979523871 4:121697222-121697244 CGCCGCTCCCCCGAGGGCCCCGG + Intergenic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
983077691 4:163344572-163344594 CGCAGCTGCCTCCCGGGCTCGGG - Exonic
985212807 4:187613286-187613308 TCCTGCCGCCCCGCGGGCCCTGG - Intergenic
985727623 5:1524200-1524222 CGTGGCAGCCTCGCGGGCCCGGG - Intergenic
986320969 5:6632806-6632828 CGCCGCCGCCTCGCAGGCCTCGG + Intronic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991587735 5:68216444-68216466 CACCGCCGCCTCGCCCGCCCCGG - Intronic
992627629 5:78649060-78649082 CGCCGCTGCCCGGCGGGCTCAGG - Intronic
992765098 5:79991134-79991156 TGAGGCCGCCTCGCGGGCCAGGG - Intronic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
993905740 5:93621299-93621321 CCCCGCCCCCTCGCGGGCGCGGG + Intronic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
998366872 5:141637603-141637625 CTTCGCCGCCTCACCGGCCCCGG - Exonic
998583711 5:143404534-143404556 CGCCGCCGCCTCGCAGACTCGGG - Intronic
1001065115 5:168529687-168529709 CGCCGCCGCGCCCCCGGCCCCGG - Exonic
1001382228 5:171312289-171312311 CGCATCCTCCTCGGGGGCCCGGG - Intergenic
1001724878 5:173888395-173888417 CGCCACCGCCTCCCGGTGCCCGG - Exonic
1002131923 5:177087120-177087142 CCCCGCCGCCTCTCGCCCCCTGG - Intronic
1002186346 5:177456493-177456515 CGCCCCCGCCTGGCGGGCCTTGG + Intergenic
1002515301 5:179753742-179753764 AACCTCCGCCTCCCGGGCCCGGG + Intronic
1002541263 5:179907843-179907865 CGCTTCCGTCTCGCGGGCCTCGG - Exonic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004395694 6:15245249-15245271 CTCCTCCGCCCCCCGGGCCCCGG - Intergenic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005328008 6:24720800-24720822 CTCGGGCGCCTCGCGGGTCCGGG + Exonic
1005766341 6:29015310-29015332 AGCCGCCTCCTCGCGGGGCAGGG + Intergenic
1006535609 6:34696648-34696670 CGCCGCCGCGCCGCCGGGCCCGG + Exonic
1006860847 6:37170681-37170703 CGCCGCCGCCCCGCATCCCCGGG - Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1011607257 6:89117698-89117720 CGGAGCCTCCCCGCGGGCCCAGG - Intronic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1014246884 6:119078742-119078764 CGCCGTCCCCGCGCGCGCCCTGG - Exonic
1015799260 6:137044431-137044453 CGCCGTCGCCTCGCGCACCTTGG - Intronic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1016982151 6:149863732-149863754 AGCCGCCGCTGCCCGGGCCCGGG + Exonic
1017672001 6:156777790-156777812 CGCCCCCGCCTCCAGGTCCCGGG - Intergenic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1018936443 6:168276855-168276877 AGGCGCGGCCTTGCGGGCCCTGG - Intergenic
1019112127 6:169724596-169724618 CGCCCCCTCCCCGCGGCCCCCGG + Intronic
1019279591 7:193104-193126 CGGCGCCGCCTCGCGGGTCAAGG - Exonic
1019303699 7:322392-322414 CCCCGCCGCCCCGCAGACCCAGG + Intergenic
1019453226 7:1110408-1110430 CGCCGGCACCTCCCGGGCCAAGG + Intronic
1019476515 7:1247198-1247220 CGCTGCTCCCACGCGGGCCCGGG - Intergenic
1019498628 7:1353061-1353083 CGCCGCCGCCACCCAGGCCGAGG - Intergenic
1020106161 7:5423273-5423295 CGCCCCCTCCCCGCCGGCCCTGG + Intronic
1020169413 7:5833416-5833438 ACCCCCCGCCTCGCGGGCACAGG - Intergenic
1020278253 7:6637383-6637405 CGCCGCCGGCCCGCAGGCCCCGG + Exonic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1022207483 7:28179425-28179447 CCCCGGCGTCTCCCGGGCCCGGG + Intronic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1024579795 7:50792849-50792871 CGCCGGCGGCTCGCGGGCTGTGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026941358 7:74289663-74289685 GGCCTCCTCCTCTCGGGCCCGGG - Exonic
1029238696 7:99143673-99143695 CGGCGCCCCCTCGCCCGCCCCGG - Intronic
1029440272 7:100583453-100583475 GGACTCCGCCTCGCGGGCCCTGG - Intronic
1029896497 7:103989714-103989736 CGCCGCCGCCACACGTGTCCCGG + Intergenic
1030138704 7:106284573-106284595 CGCCGCCGCCGCGCGCCCCCAGG + Intronic
1030348310 7:108456636-108456658 CGCCGGCGCCTCGAGGGACTGGG + Intronic
1030884771 7:114923061-114923083 CGCTGCGGCCCCACGGGCCCGGG - Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031134846 7:117873356-117873378 CGCCGCGTCCTCCGGGGCCCGGG + Exonic
1032344326 7:131105841-131105863 CGCCCTCGCCTCCCGCGCCCCGG + Intergenic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1034441157 7:151086690-151086712 CGCCTCCGCCGCGCCGCCCCGGG + Intronic
1034494012 7:151409645-151409667 CGGAGCCGCCGCGCGGACCCCGG - Intronic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1035021504 7:155803608-155803630 CGCCGCCAGCACGCGGTCCCCGG + Exonic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035187705 7:157139150-157139172 CGCCGCGTCCTCGCTGCCCCGGG + Exonic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1036379508 8:8227968-8227990 CGGCCCCGCCTCCCGGACCCTGG + Intergenic
1036850049 8:12194647-12194669 CGGCCCCGCCTCCCGGGCACTGG - Intergenic
1036871413 8:12436920-12436942 CGGCCCCGCCTCCCGGGCCCTGG - Intergenic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1040545892 8:48397439-48397461 CGCAGAGGCCTCGTGGGCCCTGG + Intergenic
1041686819 8:60652204-60652226 CGCCTCCGCCTCGCAGACTCCGG + Intergenic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042791970 8:72617789-72617811 CGCCACCTCCCCGCCGGCCCCGG + Intronic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1044719832 8:95134250-95134272 CGCCGCCGTCCCGCCAGCCCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045547370 8:103140801-103140823 CGCCGCCTCCTTGCGGGCCGGGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049620935 8:143598004-143598026 GGCCGCCGCCCCCCGCGCCCGGG + Exonic
1049663076 8:143829126-143829148 CGCCCCCGCCTCACGCGACCCGG + Intronic
1049719566 8:144109410-144109432 CGCCGCCGCCTGCAGGTCCCAGG - Exonic
1049788442 8:144462382-144462404 CGCCGCCGCCTCGGCCGCCTCGG + Intronic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1051780527 9:20684221-20684243 CCCCGCCGCCTCGAACGCCCGGG - Intronic
1052824987 9:33167686-33167708 CGCCGCCGCGCTGCAGGCCCAGG - Intergenic
1054350384 9:64014234-64014256 CGCCGCCGAGAAGCGGGCCCTGG - Intergenic
1054798642 9:69325428-69325450 CGCTGCGGCCGCGCTGGCCCCGG + Intronic
1056746761 9:89310438-89310460 CGCCGCCACCGCGCCGGCTCCGG + Intergenic
1056773748 9:89497538-89497560 CACCGCCCCCTCCCTGGCCCGGG + Intronic
1057221917 9:93262034-93262056 CACCGCTGCCTGGCGGGCCCGGG + Exonic
1057298933 9:93865448-93865470 AGCTGCCGCCTCTCAGGCCCTGG + Intergenic
1057361218 9:94374987-94375009 AGCGGCGGGCTCGCGGGCCCTGG - Intronic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057662145 9:97013177-97013199 AGCGGCGGGCTCGCGGGCCCTGG + Intronic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1060555309 9:124504813-124504835 CGCCCCCGCCTCCCCGTCCCCGG - Intronic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1061540704 9:131276802-131276824 CGGCGCCCACTCGCGGGCGCGGG + Intergenic
1061540916 9:131277534-131277556 CGCCGCCGACTCACCTGCCCCGG + Intergenic
1061610047 9:131740044-131740066 TGCGGCCGGCTCGCGGGCCGGGG - Intronic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062501942 9:136855446-136855468 AGCCGCTGCCTCCTGGGCCCCGG + Exonic
1062584183 9:137241588-137241610 CTCCCCCGCCCCGCGCGCCCTGG - Intronic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1185431644 X:14756-14778 CTCCTCGGCCTCGTGGGCCCGGG - Intergenic
1185432907 X:19771-19793 CTCCTCGGCCTCGTGGGCCCGGG - Intergenic
1185440968 X:227475-227497 CTCCTCGGCCTCGTGGGCCCGGG - Intergenic
1185442259 X:232593-232615 CTCCTCGGCCTCGTGGGCCCGGG - Intergenic
1186463358 X:9765645-9765667 GGCCGCCGGCCCGCGGGCCCCGG - Exonic
1187770154 X:22686508-22686530 CCCCTCCGCCTCGGGGTCCCTGG - Intergenic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic
1198534500 X:137573750-137573772 CGCCGCCTCCGCCCCGGCCCCGG - Intronic
1199760222 X:150899020-150899042 CGCTGCCGCCTCCCGCTCCCCGG - Intergenic
1199793951 X:151177868-151177890 CGCCGCCGGCCCCCGGCCCCCGG - Intronic
1199942222 X:152637932-152637954 CGCAGCTGCCGGGCGGGCCCTGG + Intergenic
1200003153 X:153072351-153072373 CCCCTCCGCGTCGCCGGCCCGGG - Intergenic
1200004570 X:153077658-153077680 CCCCTCCGCGTCGCCGGCCCGGG + Intergenic
1200284265 X:154805431-154805453 CTCCGCAGCCCCGCAGGCCCCGG - Exonic
1201151559 Y:11097912-11097934 CGCCGCCGAGAAGCGGGCCCTGG - Intergenic