ID: 1185278901

View in Genome Browser
Species Human (GRCh38)
Location 22:49961558-49961580
Sequence GGTGCTGGAGCGGCCCGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185278896_1185278901 -6 Left 1185278896 22:49961541-49961563 CCCGACGGCTTCCTGCTGGTGCT 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG 0: 1
1: 0
2: 1
3: 16
4: 267
1185278891_1185278901 19 Left 1185278891 22:49961516-49961538 CCGCCTGCTGGACTGGTTCGAGC 0: 1
1: 0
2: 0
3: 8
4: 62
Right 1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG 0: 1
1: 0
2: 1
3: 16
4: 267
1185278897_1185278901 -7 Left 1185278897 22:49961542-49961564 CCGACGGCTTCCTGCTGGTGCTG 0: 1
1: 1
2: 2
3: 46
4: 221
Right 1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG 0: 1
1: 0
2: 1
3: 16
4: 267
1185278893_1185278901 16 Left 1185278893 22:49961519-49961541 CCTGCTGGACTGGTTCGAGCGGC 0: 1
1: 0
2: 1
3: 4
4: 41
Right 1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG 0: 1
1: 0
2: 1
3: 16
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185278901 Original CRISPR GGTGCTGGAGCGGCCCGAGC CGG Exonic
900109872 1:1000810-1000832 GGTGATGGCGCGGGCCGGGCCGG + Intergenic
900113801 1:1020274-1020296 CGCGCTGGAGCGGCGCGAGGAGG + Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900251507 1:1672709-1672731 GGGGCTGGAGGGGCACAAGCTGG - Intronic
900913601 1:5619214-5619236 GTTGCTGGAGCCACCAGAGCTGG - Intergenic
901628995 1:10639160-10639182 GGAGCTGGAGCTGCCGGAGGAGG - Exonic
903155127 1:21437532-21437554 GGTGCTGGGGAGGTCTGAGCTGG + Intergenic
907517301 1:55000677-55000699 AGTGCTGGAGCGGTCTGGGCTGG + Intronic
915168834 1:153963677-153963699 GGAGCGGGAGCGGGCGGAGCAGG + Intronic
919092836 1:192994709-192994731 GGGGCTGGAGCAGCCGGAGCAGG + Intergenic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
924823569 1:247517908-247517930 GGTTCTGGAGAGGCCAAAGCTGG + Intronic
1063381262 10:5587681-5587703 GGTCCTGGAGCAGCCCCACCTGG - Intergenic
1063393623 10:5666400-5666422 GGTGGTGGCGCGCCCCGCGCTGG - Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1066988407 10:42488738-42488760 GGTGAGGGAGTGGCCTGAGCTGG - Intergenic
1069065666 10:63939265-63939287 GGTGCTGGAGATGTCAGAGCTGG + Intergenic
1069850940 10:71404631-71404653 TGTGCTGGAGCGGGAAGAGCAGG - Intronic
1070786128 10:79163136-79163158 GGTGCTGGGGCAGCCCGGGAGGG + Intronic
1072188000 10:93060603-93060625 GGCGCCGGGGCGGCTCGAGCTGG - Intergenic
1072744563 10:97930653-97930675 GGTGGAGGAGCTGCCCGACCAGG + Intronic
1075438369 10:122461364-122461386 GGTGCTGGCGGGGCGCGGGCGGG - Intergenic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1076343661 10:129766330-129766352 TGGGCTGGAGAGGCCCGTGCAGG + Intronic
1077094056 11:791926-791948 GGTCCTGCAGCAGCCCCAGCAGG + Exonic
1077554758 11:3220617-3220639 GTCGCTGGAGCGGGCCGAGCAGG - Intergenic
1077881632 11:6354948-6354970 GGGGCTGGAGTGGCCAAAGCCGG - Intergenic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079233630 11:18671360-18671382 GGGGCTGGAGGGCCCCGAGGAGG + Intergenic
1083366884 11:62146762-62146784 GGAGCAGGAGCGGCGGGAGCAGG + Exonic
1083366886 11:62146777-62146799 GGAGCAGGAGCGGCGCGAGCAGG + Exonic
1083366888 11:62146792-62146814 CGAGCAGGAGCGGCGCGAGCAGG + Exonic
1083366894 11:62146822-62146844 GGAGCAGGAGCGGCGCGAGCAGG + Exonic
1083681327 11:64353141-64353163 GGAGCTGGAGCGGGCACAGCTGG + Exonic
1083939571 11:65888429-65888451 GGGGCCGCAGCGCCCCGAGCAGG + Exonic
1084000253 11:66292094-66292116 GGCGCTGGGGGGGCCGGAGCCGG + Intronic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1084644722 11:70449125-70449147 GGGGCTGGAGCGACCTGAGATGG + Intergenic
1085525325 11:77160462-77160484 GGGCCTGGGGCGGCCAGAGCTGG - Intronic
1088504378 11:110514060-110514082 AGTGCTGCAGGGGCCCGTGCTGG - Intergenic
1088847985 11:113683609-113683631 GGTGCTGGAGGGAACCAAGCTGG - Intergenic
1091381910 12:67239-67261 GCTCCTGGAGCAGCCCCAGCGGG + Exonic
1092022305 12:5212677-5212699 GGTGCATGAAGGGCCCGAGCTGG - Intergenic
1097969969 12:65623070-65623092 GGTGGTGGAGGGGCCCTAACAGG + Intergenic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1101873459 12:108583344-108583366 AGTGTTGGAGAGGCCAGAGCAGG - Intergenic
1102151019 12:110689176-110689198 GGGGCGGGGGCGGCCCGGGCGGG - Intronic
1103392483 12:120584623-120584645 GCGGCTGGCGCAGCCCGAGCCGG - Intergenic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1109091861 13:58056767-58056789 GGTGCGGGAGGGGCCCAAACAGG - Intergenic
1110326201 13:74218482-74218504 GGTGCTGGAGGGTGCGGAGCGGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113653955 13:112056845-112056867 GGGGCTGGCGCTGCCGGAGCCGG + Intergenic
1113917658 13:113884039-113884061 GGTGCTGGAGCCTCGCGAGGAGG - Intergenic
1115768478 14:36647317-36647339 GGTGCTGGCGCGGCGGGAGTCGG - Intergenic
1118984571 14:70742492-70742514 GGAGCAGGAGCTGGCCGAGCGGG - Exonic
1119701982 14:76761803-76761825 GGCGGTGGCGCGGCCCGGGCGGG - Intergenic
1121436121 14:93921340-93921362 GGTGCTGGGGCTGGCTGAGCCGG + Intronic
1122937453 14:104966699-104966721 GGGGCTGGGGTGGCCCCAGCTGG - Intronic
1122959446 14:105087750-105087772 GGCGCTGGCGCGGGGCGAGCTGG + Intergenic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1202922649 14_KI270724v1_random:1180-1202 GGTGCTGCAGGGGCACGGGCGGG + Intergenic
1124146992 15:27137016-27137038 TGGGCTGGAGCGGCGAGAGCTGG - Intronic
1126095556 15:45087218-45087240 TGTGCTGGAGTGGCCCCAGATGG - Intergenic
1128334040 15:66774589-66774611 TGTCCTAGAGCGGCCCCAGCAGG - Intronic
1128497319 15:68205970-68205992 GGTGGTGGAGGGGCCTGAGCCGG + Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1130707561 15:86247714-86247736 AGTCCTGGTGCAGCCCGAGCAGG - Exonic
1131275712 15:90978841-90978863 GGTGGGGGAGCGCCCTGAGCCGG + Intronic
1131977496 15:97960987-97961009 GCTGCTGGAGGCGTCCGAGCCGG + Exonic
1132516568 16:368752-368774 GGTGCTGAGGCGGCCCCACCCGG - Intronic
1132550526 16:552162-552184 GGTGCTGGAGCGGGCCTCGCTGG + Exonic
1132554080 16:565037-565059 GGCGTGGGGGCGGCCCGAGCTGG + Exonic
1132682789 16:1150238-1150260 GGTGCTGGAGAGGCTCCAACTGG + Intergenic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1132993718 16:2811771-2811793 GGTGCTGGAGCTGGCCCAGAGGG + Intergenic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134561707 16:15215627-15215649 GATGCTGGAGCGGGCCCCGCAGG - Intergenic
1134922245 16:18127253-18127275 GATGCTGGAGCGGGCCCCGCAGG - Intergenic
1136056746 16:27695375-27695397 GGGGCTGGAGCGGAGCCAGCAGG - Intronic
1137441757 16:48504131-48504153 GGTGTTGGAGGGGCCCAGGCTGG + Intergenic
1138416451 16:56874314-56874336 GGTGCAGGAGGCGCCAGAGCTGG + Intronic
1138561343 16:57802477-57802499 TGTGCGGGAGGGGCGCGAGCGGG - Exonic
1139489432 16:67278769-67278791 GTTCCTGGAGCGCCCCCAGCAGG + Exonic
1142190149 16:88713676-88713698 GGTGGTGGTGCGGCCCATGCGGG + Exonic
1142224970 16:88872790-88872812 GGTCCTGGGGCGGCCCTGGCAGG + Intergenic
1142264244 16:89056451-89056473 GGTGCTGGAGCCGCCTGAACCGG - Intergenic
1142474215 17:180264-180286 GGTGCCTGTCCGGCCCGAGCCGG - Intronic
1142858881 17:2749354-2749376 GGCGCCGGAGCGGCCCCAGGGGG - Intergenic
1144767642 17:17741380-17741402 GGTGATGGAGGGGCCCGGGAGGG - Intronic
1145302113 17:21648060-21648082 GGTGCTGGAATGGTCTGAGCTGG + Intergenic
1145348197 17:22055256-22055278 GGTGCTGGAATGGTCTGAGCTGG - Intergenic
1145415382 17:22710128-22710150 GGTGCTGGAATGGTCTGAGCTGG + Intergenic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148754516 17:49965662-49965684 GGTGCTGGAGTTTTCCGAGCAGG + Intergenic
1148787158 17:50150991-50151013 GGCGGCGGAGCGGCCCGGGCCGG - Intergenic
1148839311 17:50484501-50484523 GGTGCAGGAGCTGCTGGAGCGGG + Exonic
1149578804 17:57733074-57733096 GGTGCTGGAGAGGACAGAGGGGG - Intergenic
1150230394 17:63546506-63546528 GGTGCTGGAGGGTTCTGAGCTGG - Exonic
1151569713 17:74920160-74920182 GAAGCTGGAGCGGCGCAAGCAGG - Exonic
1151780303 17:76240744-76240766 GGGGCGGGACCGGCCGGAGCTGG + Intergenic
1152034555 17:77864100-77864122 GGTCCTGGAGTGGCCCACGCCGG - Intergenic
1152218447 17:79047950-79047972 GATGCTGGAGCTGCGAGAGCAGG + Exonic
1152656237 17:81520287-81520309 GAAGGTGGAGAGGCCCGAGCTGG + Intronic
1152751624 17:82065147-82065169 GGTACTGGAGCGGCCTTAGAAGG - Exonic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1153805662 18:8706502-8706524 GGGGCCGGAGCATCCCGAGCGGG + Intronic
1153988568 18:10374926-10374948 GGTGCTGGAGCTGGGAGAGCAGG + Intergenic
1154214875 18:12408321-12408343 GGGGCGGGGGCGGCCGGAGCCGG + Intronic
1154294717 18:13138001-13138023 AGTGTGGGAGCGGCCTGAGCAGG + Intergenic
1155264349 18:24076465-24076487 GCTGCTGGAGCGGCCCCTGTAGG + Intronic
1155507524 18:26548041-26548063 CGTGCTGCAGCGCCCCGAGCGGG - Intronic
1158233645 18:55287598-55287620 GGAGCAGGAGAGGCCTGAGCAGG + Intronic
1158964668 18:62612025-62612047 GTTGCTGGGGAGGCCCGACCTGG + Intergenic
1159505354 18:69328434-69328456 GGTGCTGGAGGAGGCTGAGCAGG - Intergenic
1160026039 18:75217062-75217084 GGTGGTGGAGAGGCCTGGGCAGG + Intronic
1160509831 18:79447211-79447233 GGGGCTAGAGGGGCCCGGGCAGG - Intronic
1160686536 19:439320-439342 GGTGGTAGAGGGGCCAGAGCTGG - Intronic
1160789505 19:917134-917156 GGGGCTGGAGGGGGCGGAGCAGG - Intergenic
1160939187 19:1612175-1612197 GGTGCTGGGGCAGCCCTGGCCGG + Intronic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161801395 19:6418433-6418455 GGTTCTGGAGAGGCACGGGCAGG - Intronic
1161950931 19:7467510-7467532 GGAGCAGGAGCGGGCCGAGCTGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163271147 19:16254685-16254707 TGTGCAGGAGGGGCCCCAGCAGG + Intergenic
1163654829 19:18539583-18539605 GGTGCAGGAGGAGCCGGAGCTGG - Exonic
1163851864 19:19668910-19668932 GGGGCTGGAGCAGCCAGAACAGG - Exonic
1165158732 19:33803566-33803588 GGTGCTGGAGAGTCTCGTGCTGG + Intronic
1166354120 19:42217136-42217158 GGTGCGGGAGCGGCCCTGCCCGG - Intronic
1167724551 19:51201334-51201356 GGTCCTGGAGCTGCCCCAGGTGG + Intergenic
1167758207 19:51426521-51426543 GGTCCTGGAGCTGCCCCAGGTGG - Intergenic
1167863575 19:52305759-52305781 GGTGAGGGAGTGGCCTGAGCTGG + Intronic
1168097451 19:54123767-54123789 GGAGCTGGAGCGGCTGGAGGAGG + Exonic
1168241742 19:55092221-55092243 GGAGCTGGAGCGGGCCACGCAGG - Exonic
927496328 2:23554078-23554100 GGGGCTGGAGCAGCCCCAGGAGG + Intronic
927847487 2:26479142-26479164 GCTGCAGGAACGGCCCCAGCAGG - Intronic
927982119 2:27380683-27380705 GCGGCGGGAGCGGCCTGAGCTGG - Exonic
928277981 2:29920215-29920237 GGTGCTGGAGCTGGGCGAGGAGG - Exonic
929070739 2:38028658-38028680 GGGGCTGCAGCGGGCAGAGCTGG - Intronic
932493330 2:72134721-72134743 GGTGCTGGTGCTGCCCGTGAGGG + Intronic
938795995 2:134718797-134718819 GGTGCGCGAGCCGCCCCAGCTGG - Exonic
941384914 2:164841327-164841349 GGGGCTGGAGCGGCTCGGGCGGG - Exonic
944412113 2:199456220-199456242 GCTGCCCGAGGGGCCCGAGCCGG + Intronic
948008956 2:234635483-234635505 GGTGCTGGAGTGACCCTATCAGG + Intergenic
948365414 2:237451639-237451661 GGAGCTGCAGCGGCCACAGCGGG - Intergenic
948388993 2:237598633-237598655 GATGCTGGAGGGGACGGAGCAGG - Intronic
948847175 2:240688627-240688649 AGTGCTGGACCCGCCTGAGCGGG + Intergenic
1170595222 20:17800406-17800428 ACTGCTGGAGCTGCCAGAGCAGG + Intergenic
1171123036 20:22582158-22582180 GGTGGTGGGGCGGGCCCAGCAGG + Exonic
1171518700 20:25759488-25759510 GGTGCTGGAATGGTCTGAGCTGG + Intergenic
1172109436 20:32536591-32536613 CCTGCTGGAGCGGCTCGCGCGGG + Intronic
1172426453 20:34859526-34859548 GTTGCTGCATCGGCCCGACCTGG - Exonic
1173495265 20:43513976-43513998 GGTGCTGGAGCTGGCCGGCCCGG - Exonic
1175443525 20:59006335-59006357 GGTGCTGGCGTGGGCCCAGCAGG + Exonic
1175951984 20:62588470-62588492 AGTGTTGGAGCTGCCTGAGCCGG - Intergenic
1175979047 20:62727904-62727926 GGTGCTGGGTCGGCCCACGCCGG - Intronic
1176132157 20:63500717-63500739 GGTGCTCGAGTGGCCCAGGCCGG + Intergenic
1176283292 20:64327594-64327616 GCTCCTGGAGCAGCCCCAGCGGG - Intergenic
1176383612 21:6126260-6126282 GGTACTGAAGCAGCCCCAGCAGG + Intergenic
1179022984 21:37656604-37656626 GGAGCTGGAGCGGCTGGGGCTGG + Intronic
1179513738 21:41892280-41892302 GGAGCTGGAGAGGCGGGAGCAGG + Intronic
1179739858 21:43411978-43412000 GGTACTGAAGCAGCCCCAGCAGG - Intergenic
1179906568 21:44426030-44426052 GGTGGTGGAGGGGCCTGAGGGGG + Intronic
1180061015 21:45385114-45385136 GGAGCTGGAGCTGCTGGAGCTGG - Intergenic
1180150380 21:45944183-45944205 GGTGCAGGGGCAGCCAGAGCTGG + Intergenic
1180701157 22:17782087-17782109 GGTGCTGGGGCAGGGCGAGCAGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183415312 22:37678434-37678456 GGGGCTGGAGCTGGCCGAGGTGG + Intronic
1184369397 22:44072994-44073016 GGTGCTGGAGCCCTCAGAGCAGG + Intronic
1184665857 22:45988722-45988744 GGTCCTGGAGCTGCCCCATCAGG - Intergenic
1184825776 22:46949903-46949925 GGGGCTGGAGCAGCCTGAGCAGG + Intronic
1185258133 22:49848113-49848135 GGTGCTGGAGCCGGGGGAGCTGG - Intergenic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1185317923 22:50186634-50186656 GGTGCTGGGGGAGGCCGAGCGGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
953981370 3:47414782-47414804 GGTGCTGGAGTGGCCCGGCACGG - Intronic
954413450 3:50381269-50381291 GGAGCTGGGGCAGCCCCAGCTGG - Intronic
961745033 3:129059331-129059353 GGTGCTGGAGCTGCCAGGCCAGG - Intergenic
965977309 3:174641036-174641058 GGGGCTGGTGGGGCCAGAGCAGG + Intronic
967577168 3:191107724-191107746 GGAGCTGGAGCAGCTGGAGCTGG - Intergenic
968021436 3:195394172-195394194 GGTGCTGGAGGGGCACGGGAGGG - Intronic
968092794 3:195909048-195909070 GCTGCTGCAGCAGCCCGAACCGG - Intronic
968471961 4:786515-786537 TGTCCTGCAGCGGCCCGGGCAGG + Exonic
968916615 4:3499582-3499604 GGTGCTGGGGAGGGCAGAGCAGG - Intronic
971572078 4:28225675-28225697 GGAGCTGGAGCTGACAGAGCTGG - Intergenic
976557080 4:86462040-86462062 GGTGAGGGAGTGGCCTGAGCTGG - Intronic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
981081505 4:140643123-140643145 GGTGCTGGATGGGCCCGTGGTGG - Intronic
985500863 5:244136-244158 GGTGAGGGAGTGGCCTGAGCCGG - Intronic
985547378 5:516485-516507 GGTGCTGGAACTGCCCAACCTGG - Intronic
985572914 5:659787-659809 GGTACTGGAGGGGCCCCAGGTGG - Intronic
985685803 5:1280892-1280914 GGGGCTGGAGCGGCCACACCTGG + Intronic
986321214 5:6633747-6633769 GGTGCAGGAGCTGCCCTCGCTGG + Exonic
990149567 5:52800754-52800776 GGTACTGGAGCGCATCGAGCAGG + Exonic
991088186 5:62667646-62667668 GGTCCTGGTGGGGCCAGAGCTGG + Intergenic
992084848 5:73269287-73269309 GGTCCTGGAGCAGCTGGAGCTGG + Intergenic
992473154 5:77077413-77077435 GGAGCTGGAGCGGCGCGAGCTGG - Exonic
993529226 5:89003983-89004005 GGTGAGGGAGAGGCGCGAGCGGG - Intergenic
996369348 5:122736690-122736712 GGTGCTGAAGAGGCCAGGGCAGG + Intergenic
997521418 5:134526437-134526459 GGAGGTCGAGCGGCCCGGGCGGG + Intronic
998280360 5:140801353-140801375 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998282748 5:140828247-140828269 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998283341 5:140834539-140834561 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284051 5:140841477-140841499 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284707 5:140848651-140848673 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998285439 5:140856201-140856223 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998286652 5:140869259-140869281 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287290 5:140875628-140875650 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287950 5:140882424-140882446 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
999376426 5:151089581-151089603 GGAGCTGGAGCGACATGAGCTGG + Intronic
1001960914 5:175880009-175880031 TGTCCTGCAGCGGCCCGGGCAGG - Exonic
1002895587 6:1378397-1378419 AGTCCTGGAGAGGCCCGCGCCGG + Intergenic
1003405461 6:5823932-5823954 GGGGCTGGAGAGGGTCGAGCTGG - Intergenic
1005966604 6:30731031-30731053 GGTGGTGGAGCGGGCCCAGCAGG - Exonic
1006378417 6:33684348-33684370 TGTGCTGGATCAGCCTGAGCCGG - Exonic
1006421769 6:33939006-33939028 GGTGCAGGAGCGGACAGAGGGGG - Intergenic
1006860994 6:37171238-37171260 GATCCTGGAGAGGCCCGAGCCGG + Exonic
1007751273 6:44073417-44073439 GGAGCCGGAGCGGCGCGGGCGGG - Intergenic
1007769384 6:44180704-44180726 GGGGCTGGAGGGGCCCGAGTGGG + Intronic
1007826639 6:44605823-44605845 CCTGCTGGAGAGGCCCAAGCTGG - Intergenic
1016590184 6:145735411-145735433 GGTGGGGTCGCGGCCCGAGCTGG - Exonic
1017146775 6:151241260-151241282 CCTGCGGCAGCGGCCCGAGCAGG + Intronic
1017827048 6:158089372-158089394 AGTGCTTGTGCGGCCCCAGCAGG + Intronic
1019198677 6:170296736-170296758 GGTGCTGCAGGAGCCCGCGCGGG + Intronic
1019292612 7:257929-257951 GGTGCTGGAGATGCCCGGGGTGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1020050826 7:5080502-5080524 GGTGGTGGAGCAGCCCGCACTGG + Intergenic
1020094893 7:5362730-5362752 GGTGCTGGATGGGCCCGTGGTGG - Exonic
1022089929 7:27101505-27101527 GGAGGTGGAGGGGTCCGAGCGGG + Intronic
1022310725 7:29194262-29194284 GGTGCTGGGGAGGCCGGGGCCGG - Intronic
1023049164 7:36236241-36236263 GGGGCTGGCGAGGCCGGAGCCGG + Intronic
1023220525 7:37916770-37916792 GGGACTGGAGCTGCCCGGGCGGG - Exonic
1023353063 7:39339661-39339683 GGAGCTGGAGCTGCTGGAGCTGG - Exonic
1023638618 7:42237247-42237269 GATGCCGGAGCTGCACGAGCGGG - Intronic
1025122663 7:56318381-56318403 GGTGAGGGAACGGCCTGAGCCGG - Intergenic
1031918195 7:127582625-127582647 GGAGCTGGAGCGGTGCCAGCTGG - Exonic
1032151592 7:129434308-129434330 GCTGCTCGACCGGCCGGAGCGGG - Intronic
1032222866 7:130007609-130007631 GGCGTTGGGGAGGCCCGAGCTGG - Intergenic
1032525460 7:132576196-132576218 GGAGGTGCAGCGGCCGGAGCAGG - Intronic
1032679548 7:134167836-134167858 GGTGCTGGAGAGGCCAGACGGGG - Intronic
1033589121 7:142796120-142796142 GGTACTGGAACGGCTGGAGCTGG - Intergenic
1034440421 7:151083175-151083197 GGACCTGGAGGGGGCCGAGCTGG - Intronic
1037950963 8:23018621-23018643 GGTGATTGAGGGGCCCGGGCTGG + Intronic
1038424241 8:27454213-27454235 GGAGCTGGTGCGGGCCGTGCTGG + Exonic
1039424918 8:37477726-37477748 GGTGCAGGAGAGGCCAGTGCTGG - Intergenic
1043053350 8:75407943-75407965 GCTCCGGGAGCGGCCCGCGCAGG + Intronic
1044229451 8:89757746-89757768 GGAGCTCGGGCGGCCGGAGCTGG + Exonic
1045224883 8:100234848-100234870 GGTGATGGAGCCTCCAGAGCAGG + Intronic
1045417612 8:101982957-101982979 GGTGCTGAAGCTGCCCAAGATGG - Intronic
1045487813 8:102645930-102645952 GCTGCTGCAGTGGACCGAGCAGG - Intergenic
1045664986 8:104474820-104474842 GGGGCTGGAGCAGGCAGAGCAGG + Intergenic
1048244166 8:132775508-132775530 GGAGCAGGAGCGGAGCGAGCTGG - Exonic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1049237152 8:141518152-141518174 GGGCCGGGAGCGGCCCGCGCAGG - Intronic
1049585455 8:143430662-143430684 GGTCCCGGAGCAGCCCGAGGCGG - Intergenic
1049587133 8:143437379-143437401 CGTGCTGGAGGGGCCTGACCAGG - Intergenic
1049587519 8:143438903-143438925 GCTGCTGGAGCGGCCACCGCAGG - Intronic
1049631100 8:143658072-143658094 GGTGCTGGAGAGTCCCCACCAGG - Intergenic
1049799136 8:144509708-144509730 GCTGCTGGAGCCGGCCGAACTGG + Exonic
1049818301 8:144618780-144618802 GGGGCTGGGGAGGCCCCAGCAGG - Intergenic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1055030812 9:71769691-71769713 GGTGAGGGCGCGGCCCGGGCTGG + Intronic
1056856601 9:90134998-90135020 GGAGCTGCAGAGGCTCGAGCTGG + Intergenic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057227606 9:93300777-93300799 GGGGCTGGGGAGGCCCGAACTGG - Intronic
1057662207 9:97013385-97013407 CGTCCCGGAGCGCCCCGAGCTGG - Exonic
1057869401 9:98707470-98707492 GGGGCTGGAGCGCGCGGAGCGGG - Intronic
1059119780 9:111631497-111631519 GCTGCTGGTGCGGCCCGCGGGGG + Exonic
1060917953 9:127402561-127402583 GGTGCTGGAGTGGCGCTGGCTGG + Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061602730 9:131682363-131682385 GGTGATGGAATGGCCTGAGCTGG - Intronic
1062281491 9:135753891-135753913 GGTGCTAGAGGGGCCAGGGCCGG + Intronic
1062519040 9:136950065-136950087 GGCGCTGGAACGGGCCGTGCAGG - Intronic
1062715995 9:138010340-138010362 GGAGCAGGAGGGGCCTGAGCAGG + Intronic
1203563108 Un_KI270744v1:74118-74140 GGTGCTGGAGAGACCTGGGCGGG + Intergenic
1191846082 X:65549305-65549327 TGCGCTGGAGCGGCCAGAACAGG + Intergenic
1199984753 X:152942253-152942275 TGTGATGGAGCGGCCCAAGATGG - Intronic
1200036360 X:153334223-153334245 GGCGCTGGCGCGGCCCAGGCAGG - Exonic