ID: 1185281240

View in Genome Browser
Species Human (GRCh38)
Location 22:49970995-49971017
Sequence GAAGGGGGACGCTGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185281228_1185281240 6 Left 1185281228 22:49970966-49970988 CCTGTGACTCAGCACCTCCCGGA No data
Right 1185281240 22:49970995-49971017 GAAGGGGGACGCTGGTGACAGGG No data
1185281226_1185281240 9 Left 1185281226 22:49970963-49970985 CCTCCTGTGACTCAGCACCTCCC No data
Right 1185281240 22:49970995-49971017 GAAGGGGGACGCTGGTGACAGGG No data
1185281234_1185281240 -8 Left 1185281234 22:49970980-49971002 CCTCCCGGAGGCGGTGAAGGGGG No data
Right 1185281240 22:49970995-49971017 GAAGGGGGACGCTGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185281240 Original CRISPR GAAGGGGGACGCTGGTGACA GGG Intergenic
No off target data available for this crispr