ID: 1185285171

View in Genome Browser
Species Human (GRCh38)
Location 22:49996852-49996874
Sequence CCTCCAGCCCTGCAGGCATA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185285162_1185285171 30 Left 1185285162 22:49996799-49996821 CCACTGGAGCGGAGGTTGCAGAG 0: 1
1: 0
2: 10
3: 288
4: 6657
Right 1185285171 22:49996852-49996874 CCTCCAGCCCTGCAGGCATAAGG 0: 1
1: 0
2: 5
3: 29
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185285171 Original CRISPR CCTCCAGCCCTGCAGGCATA AGG Exonic
900097487 1:945922-945944 CCTCCAGCCCATCAGGCCTGAGG + Intronic
900795719 1:4707138-4707160 CCCCCAGAGCTGCAGGCACATGG - Intronic
902574961 1:17371990-17372012 CCTGCAGCTCTGCAGGCACGAGG + Intergenic
902651791 1:17842182-17842204 GCTCCAGCCATGCAGGGATCTGG - Intergenic
903961047 1:27058088-27058110 CCTCCAGCCCCGCCCGCACAGGG + Intergenic
903986917 1:27235044-27235066 GCTCCAGCCCTGCCGGCCTGGGG + Intronic
904789432 1:33007557-33007579 CCTCCAGCCTTTCTGGAATACGG + Intergenic
904804427 1:33120705-33120727 CCTCCAGGCCTGGTGCCATAAGG + Intergenic
904872539 1:33627903-33627925 ACTGCAGCCCTGAAGGCACACGG + Intronic
906005327 1:42464118-42464140 TCTCCAGCTCTGCAGTCATTGGG + Intronic
907626306 1:56033552-56033574 CCTCCAGTCCTGCCTGCATGGGG - Intergenic
907884616 1:58581226-58581248 CCTTCATCCTTGCAGGCACAAGG - Intergenic
912377597 1:109223855-109223877 CCTTCAGCTCTGCCGGCATTTGG + Intronic
914241188 1:145854198-145854220 ACTCCAGCCCTGCTAGAATATGG - Intronic
915938629 1:160104179-160104201 CCTGCAGCGCGGCAGGCATGGGG - Intergenic
918233923 1:182560540-182560562 CCTGCAGCCCTGGAGGTGTATGG - Exonic
918258299 1:182770329-182770351 CCTCCAGCATTGCTGGGATATGG + Intergenic
920049063 1:203152345-203152367 CCGCCAGCCCAGCTGGCACATGG - Intronic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
924081415 1:240401958-240401980 CCTCCAGGGCTGTAGGAATATGG + Intronic
1064504072 10:16010325-16010347 CCTCCAGTCCAGATGGCATAAGG - Intergenic
1065100518 10:22326114-22326136 CCTCCAGCCCAGCAGCCCCAAGG - Intronic
1067835787 10:49640484-49640506 CCCCCAACCCTGCAGTAATAAGG - Intronic
1069082552 10:64103847-64103869 GCTGCAGCCAAGCAGGCATAGGG + Intergenic
1069592874 10:69652701-69652723 CCTTCAAGCCTGCAGGGATAAGG - Intergenic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1071293681 10:84204334-84204356 CCTCCAGCCCTGGAGGCCAGTGG + Intronic
1073003180 10:100300468-100300490 CCTACAGCCCTACTGGCACATGG - Intronic
1074421026 10:113309128-113309150 CCTTCATCCCTGCAGGCCCAGGG - Intergenic
1075069138 10:119309085-119309107 GCACCAGCCCTGCAGGGATGTGG - Intronic
1075333760 10:121594441-121594463 CCTCCAGCCCAGCAGAAATACGG - Intronic
1075574165 10:123566450-123566472 CCTCCAACCCTACAGGCAGTTGG - Intergenic
1075616962 10:123897140-123897162 ACTCTAGCCCTGCAGTCCTATGG + Intronic
1075644135 10:124086516-124086538 CCTCCAGCTCCGCAGGCAATGGG + Intronic
1076302897 10:129441517-129441539 CCTCCAGCCCAGCAGGGCTCAGG + Intergenic
1076729719 10:132432273-132432295 GCTCCCGCCCTGCAGGCCCAGGG + Intergenic
1076796899 10:132802852-132802874 GCCCCAGCCCTGCAGGGACAGGG - Intergenic
1076975227 11:166748-166770 CCTCCATCCCTAGAGCCATAGGG + Intergenic
1077093438 11:789620-789642 CCTCCAGACCTGCAGAGAAAGGG + Intronic
1077388957 11:2290488-2290510 ACTCCAGCCCTCCAGGCATGGGG - Intergenic
1077392633 11:2307148-2307170 CCTCCAGCCCTGCAGGGACAGGG - Intronic
1078886019 11:15500678-15500700 ACTCCAGGTCTGCAGGCACAAGG + Intergenic
1081670250 11:44938626-44938648 GAGCCAGCCCTGGAGGCATAGGG + Intronic
1081734500 11:45393636-45393658 CCTCCAGACCTCCAGGCCTGAGG - Intergenic
1084569801 11:69952372-69952394 TCTGCAGCCCAGCAGGCAGACGG + Intergenic
1084693959 11:70743013-70743035 CCACCAGCACTGCAGCCACATGG - Intronic
1085023017 11:73220816-73220838 CCTCCTGCCCTGGATGCATGGGG + Intronic
1085061328 11:73449719-73449741 CCTCCTGCCATGCAGGCATAAGG + Intronic
1085337624 11:75708154-75708176 CCTCCAGCGCTGCTGGGTTAGGG - Intergenic
1085374682 11:76048917-76048939 GCTGCAGCCAAGCAGGCATAGGG + Intronic
1085641356 11:78195095-78195117 GCTCCAGCCCTGCACACCTAGGG - Intronic
1086136707 11:83449062-83449084 CCTCCAGCTGTGCAGTCATAGGG + Intergenic
1086981148 11:93198634-93198656 GCTCCAGCTCTGAAGGCAGAAGG - Intergenic
1089505846 11:118961472-118961494 CCCCCATCCCTGCAGGCTTATGG - Intergenic
1091007020 11:131962554-131962576 CCTCCAGATCTGCTGGCATCTGG + Intronic
1091667677 12:2431000-2431022 CTTCCTGCCCTGCAGGCAGAGGG + Intronic
1091673006 12:2466693-2466715 CCTCCAGCCCTGCATTCACCCGG + Intronic
1091726160 12:2848163-2848185 TCTCAAGCCCTGCAGGCACCTGG - Intronic
1094361386 12:29634977-29634999 CCTCCTGCCCTGCAGCCTGATGG - Intronic
1094427250 12:30328242-30328264 CCCCCATCCCTGCAGGCTCAGGG + Intergenic
1095848880 12:46778599-46778621 CATCCAGCCCTGCAGGATTGCGG + Exonic
1096769881 12:53928287-53928309 CGTCCCGCCCTGCAGGGATCTGG - Intergenic
1096793501 12:54059916-54059938 CATCCAGGCCTGCCGGGATAAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100263529 12:92954539-92954561 CCTCCAGCCCAGCAGGCATCTGG + Intergenic
1100362191 12:93889251-93889273 CCACTAGCCCTGGAGACATAGGG - Intronic
1100819653 12:98419598-98419620 GCTGCAGCCAAGCAGGCATAGGG + Intergenic
1102518496 12:113465366-113465388 CCTCCGGCCCGGCCGCCATATGG - Intronic
1102682950 12:114702862-114702884 CCTCCAGCCCTTGGGGAATATGG + Intergenic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1103247630 12:119471689-119471711 GCTCCTGCCCTGCAGGCACGAGG + Intronic
1104031658 12:125069294-125069316 GCTCCCGCCCTGCAGGCTTCAGG + Intronic
1104204471 12:126625006-126625028 GCTACAGCCCTGCAGCCATTGGG - Intergenic
1104240655 12:126985786-126985808 TCTCCAGCCATGCAGCCATGTGG - Intergenic
1104359502 12:128118565-128118587 GCTCCAGCCCTGTGGGAATACGG - Intergenic
1104671982 12:130686775-130686797 CCTCCGGCCCTGCAGCCATCTGG - Intronic
1105064057 12:133181606-133181628 CCTCCAGATCTGCAGCCAGAAGG - Intronic
1105507246 13:21020817-21020839 CCTCCATCCCTGCTGTCATGTGG + Intronic
1106571949 13:30935081-30935103 CATCCATCCCTGCAGGCTCAGGG + Intronic
1107875900 13:44790138-44790160 CCCCCATCCCTGCAGGCTCAGGG - Intergenic
1113878292 13:113608145-113608167 CCACATGCCCTGCAGGCATGGGG + Intronic
1113901720 13:113801555-113801577 CCCCCAGCCCTGCAGGGCTCAGG + Intronic
1114320495 14:21543338-21543360 CCTCCAGGTCTGCAGCCAGAAGG - Intergenic
1114495898 14:23131853-23131875 CCTGCAGCCTTCCAGGCATTGGG - Intronic
1116157504 14:41225811-41225833 CCTCCAGCCCTCCAAGCTTTTGG - Intergenic
1118357825 14:65029874-65029896 CCTCCAGCCCTGAAACCAGAGGG - Intronic
1121123855 14:91393344-91393366 CCCCCAGCCCTGCAGGCAGAGGG + Intronic
1122607687 14:102958408-102958430 ACTCCAGCCCTGCAGGCGAGTGG - Intronic
1122635827 14:103129206-103129228 GCTCCAGCCCTGCAGGTCTTGGG - Intronic
1122834141 14:104422964-104422986 CCTGCATCCCTTCAGGCAGAGGG - Intergenic
1123073193 14:105652199-105652221 CCTCCAGCCCAGCAAGCTTGGGG - Intergenic
1124355664 15:28993125-28993147 GCTCCATCCCAGCAGGCAGAAGG - Intronic
1124650306 15:31469259-31469281 CCTCCATCCCTGCAGGCTCAGGG - Intergenic
1125260979 15:37824296-37824318 CCCTCAGCCCAGCAGGCATCGGG - Intergenic
1125599141 15:40906252-40906274 CCTCTGGCCCTCCAGGCTTAGGG - Intergenic
1128324006 15:66711800-66711822 CCTCCAGCCCTCCAGCCCTGAGG - Intronic
1128326051 15:66724990-66725012 CCTAGAGCCCGGCAGGCAGATGG - Intronic
1128708535 15:69855119-69855141 GCTCCAGCCCTGCAGCCGAAAGG + Intergenic
1129685752 15:77685210-77685232 CCTCCAGCCCAGCAGGGAAGGGG + Intronic
1129757121 15:78105252-78105274 CATCCTGCCCTGCAGTCACATGG - Exonic
1129881455 15:79009386-79009408 CGTCCAGCCCTGGAGGCTGAAGG + Intronic
1131513502 15:93062820-93062842 CTTCCACCCCTGCAGCCAGAGGG - Intronic
1132034153 15:98466496-98466518 CCTCCAGCACTGAAGACATCAGG + Intronic
1132039763 15:98515318-98515340 CCTCCAGCCCTGAAGCAATGAGG + Intergenic
1132109960 15:99095830-99095852 CCTCACCCCCTGCAGGCAGAAGG + Intergenic
1132418663 15:101644471-101644493 CCTGCAGCATTGCAGCCATAGGG - Intronic
1132738033 16:1397148-1397170 CCTCCAACCCCCCAGGCGTAGGG - Intronic
1132850833 16:2024202-2024224 CCTCCAGCGCAGCACCCATACGG + Intergenic
1132860339 16:2067954-2067976 ACTCCAGCCCTGGAGGCCTGAGG + Intronic
1135731757 16:24900453-24900475 CCTCCAGCCCTGGTGGGATGAGG + Intronic
1135771421 16:25221138-25221160 CCTCCAGCCCTTCAGAGATGTGG - Intronic
1137032045 16:35532700-35532722 CCTCCAGCCCTCCAGGGATGGGG + Intergenic
1137554383 16:49461472-49461494 CCTCCAGGCCTCAAGGCTTAAGG + Intergenic
1138098870 16:54235543-54235565 CCTGCAGCCCTGCAGAAAGAGGG + Intergenic
1138488740 16:57363789-57363811 CCTCCCTCCCTGCAGTCAGAGGG + Exonic
1140117093 16:72051324-72051346 TCCCCAGCCCTGCAGGTATGAGG - Intronic
1140877055 16:79162538-79162560 CCTCTAGCCCTGAAGACACAGGG + Intronic
1141579659 16:84988567-84988589 CCTCCAGCTCTCCAGGCTTCTGG + Intronic
1141798281 16:86289147-86289169 CCTCCAGCCTTGCTGGGATCTGG - Intergenic
1142827885 17:2525575-2525597 CCCCAAGCCCTGCAGGGAGAGGG - Intergenic
1143715591 17:8766182-8766204 CCTCCAGGCCTGTGGGCACAGGG + Intergenic
1144581508 17:16461947-16461969 GCTCCAGCCCTGCAGAAATGAGG + Intronic
1144726334 17:17504419-17504441 CCTCCAGCCCTCCAAGGAGAGGG + Intergenic
1144899227 17:18568794-18568816 CTTCCACCCCTGCAGCCAGAGGG + Intergenic
1146674558 17:34764395-34764417 CCTCCAGCCCTGCTGGTTTTGGG + Intergenic
1146729000 17:35177980-35178002 GCTTCAGCCCTGGAGGCAGAGGG - Intronic
1148823680 17:50376647-50376669 CCCTCATCCCTTCAGGCATAGGG - Intronic
1149568597 17:57656464-57656486 CAGCCAGCCCTTCAGGGATACGG + Intronic
1149663368 17:58348489-58348511 CCCCCAGCCCTGCAGCCTGATGG + Intronic
1150220088 17:63491195-63491217 CGTCCAGCCCTGCAAGCAGAGGG - Exonic
1151343975 17:73490268-73490290 CCTCCAGCCCTGCAAGCAGTGGG - Intronic
1151359939 17:73582743-73582765 CCTTCAGCCCTTCAGATATAGGG + Intronic
1152657730 17:81527773-81527795 CGTGCAGCCCTGCAGGCAGGGGG - Intergenic
1152946197 17:83198896-83198918 CCTCCGGCCGTGCAGGCCTCTGG - Intergenic
1156290717 18:35747132-35747154 CCACCAGCCCTGCTGACACAGGG - Intergenic
1156879944 18:42064994-42065016 ACTCCAGCCCTGCAGTCACAGGG + Intronic
1157006514 18:43590037-43590059 CCTCCAGGCCTGCAGGGGAATGG + Intergenic
1157564076 18:48668077-48668099 CCTCCAAACCTGCAGGCCTCTGG + Intronic
1160024065 18:75204609-75204631 GCTCCAGCCGTGCAGTCCTACGG + Intronic
1160060298 18:75523912-75523934 CCTCTAGAGCTGCAGGCAGAAGG - Intergenic
1160159729 18:76461911-76461933 CGTCCAGCCCTGCAGGCGTGTGG + Intronic
1160191959 18:76722112-76722134 GCTGCAGCCAAGCAGGCATAGGG + Intergenic
1160409269 18:78664064-78664086 CCTCCAACCCTCCTGGCATCGGG - Intergenic
1160652182 19:236931-236953 CCTCCATCCCTACAGCCATGGGG + Intergenic
1161586726 19:5109714-5109736 CCTCCAGCCCTGCAAGCTGGAGG + Intronic
1161885837 19:6995015-6995037 CCTTCAGACCTGCCGGCACATGG + Intergenic
1162986316 19:14272461-14272483 CCTCCAGCTCTGAAGGAATGTGG + Intergenic
1163514697 19:17755820-17755842 CCTTCAGCCCTGCAGGACCAGGG + Intronic
1163726048 19:18923700-18923722 CTTCCAGCCCTGCAGTCCCAGGG + Intronic
1165027010 19:32969564-32969586 CCTCCATCCCTGCAGGCTCAGGG - Intronic
1165052531 19:33151123-33151145 CCTCCAGCCCAGCAGGTGGAAGG + Intronic
1165160598 19:33813501-33813523 GCCCCAGCCCTGCAGGCATCTGG - Exonic
1166939925 19:46356292-46356314 GCTGAAGGCCTGCAGGCATATGG - Intronic
1167169599 19:47822285-47822307 CCTCAAGCCCTGACGGCATCCGG + Intronic
1167330435 19:48852430-48852452 CCTGGAGCCCTGCAGGCGTATGG + Intronic
1168500446 19:56888396-56888418 CCTCCAGCCCGACAGCCAGAGGG + Intergenic
1168669549 19:58230182-58230204 TCCCCAGCCCTGCAGCCAGAGGG + Intronic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
927072841 2:19548278-19548300 CCCCCATCCCTGCAGGCTCAGGG + Intergenic
927672252 2:25078586-25078608 CCTCCAGCCCTGCTGGGCTCAGG + Intronic
928180519 2:29065247-29065269 CGCCCACCCCTGCAGGCACACGG - Intronic
929531784 2:42757227-42757249 CCTCCAGGCCTGGGGGCACAGGG - Intergenic
929812324 2:45201010-45201032 CCTGCACCCATGCAGGCCTAGGG + Intergenic
930918643 2:56724170-56724192 CCTCTAGCCCTGCTGGGTTAGGG + Intergenic
932645960 2:73502483-73502505 TCTCCTGCCCTCCAGGAATAGGG - Intronic
932668572 2:73717820-73717842 CTTCCAGCCTTGCAGGAACAGGG + Intergenic
933383664 2:81583440-81583462 CCTCCAAGCCTGCAAGGATATGG - Intergenic
933978320 2:87529594-87529616 CCTCCTGCCCTGCTTGGATAGGG + Intergenic
936315512 2:111421207-111421229 CCTCCTGCCCTGCTTGGATAGGG - Intergenic
937476891 2:122223630-122223652 CCTCCAACTCTGCAGGCATCAGG - Intergenic
941721040 2:168813215-168813237 CTTCCTGCTCTGCAGGCAGAAGG - Intronic
941972186 2:171363297-171363319 CCTCCAGCCCTGCTGCTTTATGG + Intronic
942446681 2:176082964-176082986 CCTCCAGCCCTGAGGGCACAGGG + Intronic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
944480941 2:200157385-200157407 CCTCAAGCCCTGCCAGCCTATGG + Intergenic
946249443 2:218403577-218403599 CCACCTGCCCTGTAGCCATATGG + Intronic
948095990 2:235334415-235334437 CCCACAGCCCTGCAGACACAAGG + Intergenic
948145944 2:235708067-235708089 CTTCCAGCCCTGCATCCATGCGG + Intronic
948256894 2:236574905-236574927 CCTCCATCCCTGCCAGCCTATGG - Intronic
948699161 2:239749649-239749671 CCTCCAGCCAAGCAGGAAGATGG - Intergenic
1168850365 20:972529-972551 CCTGCACTCCTGCAGGCATAAGG - Intronic
1169773437 20:9226160-9226182 CCACCAGTCCTCCAGCCATACGG - Intronic
1170458030 20:16551694-16551716 CCTCAAGCCCTTCTGGCTTAAGG - Intronic
1171976337 20:31597048-31597070 CCTCCAGAGCTCCAGGCAAATGG - Intergenic
1172752171 20:37258552-37258574 CCTCCAGCTCTGCAGGTACAGGG - Intronic
1173530629 20:43766786-43766808 GCCCCAGCCCTGCAGGCAGCGGG + Intergenic
1174238873 20:49116874-49116896 CCTCCAGGCCAGCAGGGAAAAGG + Intronic
1175457511 20:59126663-59126685 CCTCAGGCCATGCATGCATATGG - Intergenic
1175752757 20:61510463-61510485 CCATCAGCCCAGCAGGCATGCGG - Intronic
1176244841 20:64092594-64092616 CGTGCAGCCCAGCAGGCACATGG - Intronic
1176257515 20:64159934-64159956 CCTCAGGCCCTGCAGGCAGAGGG - Intronic
1179364012 21:40738955-40738977 GCTCCAACCCTGCAGGAAGAAGG + Intronic
1180022607 21:45137894-45137916 CCTCCAGCCCACCAGGCTTCTGG - Intronic
1181638892 22:24186750-24186772 TCTCCAGCCCTGCACGGTTAAGG + Intronic
1181943354 22:26496229-26496251 GCTCCAGCCGTGCCTGCATAAGG + Exonic
1182297174 22:29316395-29316417 CCTCCAGCCTTGCTGGGACAGGG - Intronic
1182576784 22:31278363-31278385 CCTCCAGCTCTGCAGGCAGCGGG - Intronic
1183621289 22:38974359-38974381 CCTACATCCCTGCAGTCTTAGGG - Intronic
1183712116 22:39511144-39511166 CCTCCAGCACTGCATGCTTTAGG - Intronic
1183746009 22:39692007-39692029 CCCAGAGCCCTGCAGGCATCGGG - Intergenic
1185285171 22:49996852-49996874 CCTCCAGCCCTGCAGGCATAAGG + Exonic
950100334 3:10352689-10352711 CCTCCAGCCCTGTAAGAATGAGG - Intronic
950691394 3:14660937-14660959 CCATAAGCCCTGCAGGCAGAGGG + Intronic
952711949 3:36440407-36440429 CCTGCTGTCCTGCAGGCATAAGG - Intronic
952950088 3:38515770-38515792 TCTCCAACCCTGCAGGCACTTGG + Intronic
952968373 3:38635239-38635261 CCACAACCCTTGCAGGCATATGG - Intronic
953878846 3:46681301-46681323 CCCCCAGCCCTTCAGGTACACGG - Exonic
954680912 3:52345481-52345503 TCACCAGCCCTGCAGGGATAGGG - Exonic
954752862 3:52823495-52823517 CCTCCACCTCTGCAGCCAGAGGG - Intronic
956441438 3:69284367-69284389 CCTCCAGCCCTGTAAGGATGAGG - Intronic
957514102 3:81229254-81229276 ACTCCAGCCCTGCAGACTTTTGG - Intergenic
961434335 3:126906285-126906307 CCTCCAGGCCTCCAGGCTGATGG + Intronic
962007345 3:131361814-131361836 GCACCAGCCCTGCAGGGATAAGG - Intergenic
962086708 3:132199154-132199176 CCTCAAGCCATTTAGGCATAAGG - Intronic
962326820 3:134441239-134441261 GCTCCACCCTTTCAGGCATACGG + Intergenic
962835693 3:139186448-139186470 CCTCCAGCCCCACAGGCAGCAGG - Intronic
964352759 3:155819507-155819529 CCTCCAGTCCTGTGGGCTTAGGG - Intergenic
967341739 3:188406171-188406193 TCTCCATCCGTGCAGGCACATGG - Exonic
968020058 3:195377922-195377944 CCTTCAGACCTCCAGGCAGACGG + Intronic
968545475 4:1195586-1195608 CCTCCAGCCCTGCTTGCTGAGGG - Intronic
969522435 4:7686493-7686515 CCTCCAGCCCTGCAGGAACCCGG + Intronic
970126800 4:12822792-12822814 CTTCCATCCATGAAGGCATAAGG - Intergenic
972225681 4:37008427-37008449 GCTGCAGCCAAGCAGGCATAGGG - Intergenic
974260369 4:59518328-59518350 CTTCCAGCCCTGCAGGGGCAGGG + Intergenic
975817460 4:78233958-78233980 TCTCCAGCCTTGCAGGAAGATGG + Intronic
977272639 4:94936988-94937010 CCTCCAGTCCTGGAGGCACTGGG - Intronic
979631054 4:122903670-122903692 CCTCCAGCCTTGCAGTCTAATGG - Intronic
980001833 4:127498268-127498290 CCTCCTGCCATTCAAGCATAGGG + Intergenic
981614783 4:146635017-146635039 CCTCCAGCCCCGCAGTTATCAGG - Intergenic
981833595 4:149029528-149029550 GCTGCAGCCAAGCAGGCATAGGG - Intergenic
985999561 5:3619898-3619920 CCCCCAGCCCTGCAGGGACCTGG + Intergenic
986146332 5:5081244-5081266 CATGAAGCCCTGCAGGCACATGG - Intergenic
988898692 5:35707729-35707751 GCTCCATCCCTCCAGGCATCTGG + Intronic
990333518 5:54750165-54750187 ACTGCAGCCCTCCAGTCATAGGG - Intergenic
991698870 5:69298685-69298707 CCTCCAGCCAGGCAGGAACAAGG - Intronic
993816813 5:92558728-92558750 CCTCCTGCACTGCAGGAATGAGG - Intergenic
995291762 5:110464537-110464559 TGTCCAGCCCTGCTAGCATATGG + Intronic
996399178 5:123042453-123042475 ACTCCAGGCCTCCAGGCATGGGG - Intergenic
998267106 5:140674397-140674419 CCTCTAGCCCTCTAGGCATCAGG + Intronic
1001218707 5:169880309-169880331 CCTTCTGCCTTCCAGGCATATGG + Intronic
1002094738 5:176824143-176824165 CCTCCAACCCGGGAGGCATCGGG - Intronic
1002688990 5:181037377-181037399 CCCCCATCCCTGCAGGCTCAGGG + Intergenic
1006440928 6:34053298-34053320 ACTCCAGCCCTCCTGGCCTAAGG + Intronic
1006510879 6:34520413-34520435 ACTCCAGCCCTCCTGGCCTAAGG - Intronic
1006630670 6:35427681-35427703 CCTCCAGGCCTGCAGGGGCAAGG + Exonic
1007709783 6:43815204-43815226 CCTCCAGCCATGGAGGCAGCAGG + Intergenic
1013460905 6:110374435-110374457 CCCCCAGCCATGTAGCCATAGGG - Intergenic
1018672999 6:166194976-166194998 CGTCCAGCCCTGGAGGCCAAGGG + Intergenic
1018988718 6:168657423-168657445 CCTGCAACCCTCCAGGCATTTGG + Intronic
1019280011 7:194869-194891 CCTCCAGCCCAGCAGGCAGACGG + Intronic
1020370492 7:7427035-7427057 CCTTCAGCCCTGGAGACACATGG - Intronic
1026859186 7:73773994-73774016 CCTCAAGGCCAGCAGGCGTAGGG - Intergenic
1027186024 7:75971441-75971463 CCTCTGGCCCTGCAGGCTTGGGG + Intronic
1027333791 7:77127056-77127078 CCCCCATCCCTGCAGGCTTGGGG - Intronic
1027518165 7:79168230-79168252 CCTCTAGCCCTGCTGGGTTAGGG + Intronic
1029188717 7:98756975-98756997 TCTCCAGCTCTGCAGGCAGGTGG - Intergenic
1029226912 7:99035001-99035023 CCGCCTGCCCTACAGGCAGATGG + Intronic
1029495559 7:100894227-100894249 CCGCCTGCCCTGCAGCCATGAGG - Exonic
1029737404 7:102472478-102472500 CCTCCAGCTCCACAGGCAGATGG - Exonic
1030974512 7:116105065-116105087 CCTGCAGCCCTCCAGTCCTATGG + Intronic
1031920239 7:127595085-127595107 CTTCCACCCCTGCAGCCAGATGG - Intronic
1035368770 7:158365274-158365296 CCTCCAGCCCCGCTGGCCTCCGG - Intronic
1036547406 8:9785228-9785250 CCTCCAGCCCTGCAATCAGAAGG + Intergenic
1036695014 8:10968535-10968557 CCTCCTGTCCTCCAGGCCTAGGG + Intronic
1037607859 8:20452689-20452711 CCTCCAGGCCTGCAGGCGGCTGG - Intergenic
1039558559 8:38494957-38494979 CTTCCACCCCTGCGGGCACATGG - Intergenic
1040545999 8:48398208-48398230 CCTCCAGCCATGCAAGAATGAGG - Intergenic
1047313343 8:123710611-123710633 CCTCCAGGACTGCAGCCATGTGG + Intronic
1047696006 8:127404444-127404466 CTGCCAGCCCAGCATGCATATGG + Intergenic
1048238456 8:132716163-132716185 CTTCCAAGCCTGCAGGCACAGGG - Intronic
1048473505 8:134723445-134723467 ACCCCAGGCCTGCAGGCATGCGG + Intergenic
1049503749 8:142983515-142983537 CCTGCAACGCTGCAGGCAAACGG + Intergenic
1049639613 8:143708917-143708939 CCTCCAGCCATCCGGGCACACGG - Intronic
1051813448 9:21076636-21076658 CCACCATCCCTGCAAGCTTAAGG - Intergenic
1052300861 9:26951040-26951062 CCTTCATGCCTTCAGGCATATGG - Intronic
1055335588 9:75230006-75230028 GCTGCAGCCAAGCAGGCATAGGG + Intergenic
1058408198 9:104701030-104701052 CCCCAAGCCCTGCATGCATGGGG + Intergenic
1059565444 9:115379704-115379726 CCTCCATCCCTACAGGCTCAGGG + Intronic
1060064117 9:120487805-120487827 CTTCCAGTCCTGCAGGCTTATGG + Intronic
1060907800 9:127323551-127323573 CCACTAGCCCTGCAAGCATTAGG - Intronic
1061274571 9:129562060-129562082 CTACCAGCCCTGCAGGCCTGCGG + Intergenic
1062080040 9:134618970-134618992 CCACCTGCACTGCAGGCATGTGG + Intergenic
1062149506 9:135010337-135010359 CAGGCAGCCCTGCAGCCATACGG + Intergenic
1185544621 X:933686-933708 CCTTCAGGCCTGGAGGCATAGGG - Intergenic
1186664533 X:11704173-11704195 CCTCCAGCCCTACAGGCGGCGGG + Intergenic
1189623520 X:42869883-42869905 CCTCCAGCCCTGCAGCAATTTGG - Intergenic
1190127073 X:47715484-47715506 CTTTAAGCCCTGCAGGCATTAGG - Intergenic
1192177201 X:68893471-68893493 CCTTCTGCCCTGCAGGCCTGAGG + Intergenic
1192557951 X:72105339-72105361 CCTCCCACCCTGCAGGCCTCTGG + Intergenic
1192972873 X:76252353-76252375 CATCAAGCCCTCCAGGAATATGG - Intergenic
1195308121 X:103605844-103605866 CCCCCAACCCTGCCGGCATTTGG - Intergenic
1195369246 X:104156812-104156834 CTTCCAGCCTAGCAGGCAAACGG - Intronic
1196814146 X:119651735-119651757 CCACCAGGCCTGCAGCCATGTGG + Intronic
1199541284 X:148960355-148960377 GCTGCAGCCAAGCAGGCATAGGG - Intronic
1199613875 X:149639937-149639959 GCTCCAGCCCTGCAGTCCTTAGG + Intergenic
1202043485 Y:20712555-20712577 CTTCAAGCCCTGCATGCATTAGG - Intergenic