ID: 1185287797

View in Genome Browser
Species Human (GRCh38)
Location 22:50010334-50010356
Sequence CGGGGCAGCCTCTGGGGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185287775_1185287797 25 Left 1185287775 22:50010286-50010308 CCCCAGGCTGCTGAGGGCTCCGC 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291
1185287785_1185287797 3 Left 1185287785 22:50010308-50010330 CCCAGGCAAAAGGGGCCGGGCTC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291
1185287786_1185287797 2 Left 1185287786 22:50010309-50010331 CCAGGCAAAAGGGGCCGGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291
1185287777_1185287797 23 Left 1185287777 22:50010288-50010310 CCAGGCTGCTGAGGGCTCCGCCC 0: 1
1: 0
2: 2
3: 43
4: 390
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291
1185287783_1185287797 6 Left 1185287783 22:50010305-50010327 CCGCCCAGGCAAAAGGGGCCGGG 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291
1185287776_1185287797 24 Left 1185287776 22:50010287-50010309 CCCAGGCTGCTGAGGGCTCCGCC 0: 1
1: 0
2: 3
3: 27
4: 225
Right 1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG 0: 1
1: 0
2: 0
3: 19
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185287797 Original CRISPR CGGGGCAGCCTCTGGGGAAC GGG Intronic
900001725 1:18194-18216 CTGGGCAGCCTCAGAGGCACGGG + Intergenic
900021445 1:188717-188739 CTGGGCAGCCTCAGAGGCACGGG + Intergenic
900093168 1:929355-929377 CGGGGCAGGGTTTGCGGAACAGG + Intronic
900368214 1:2320088-2320110 CGGGGCAGCCCCTGGGCACATGG - Intergenic
900537860 1:3187632-3187654 CGGGGCAGCCTCTGGTCCCCAGG - Intronic
900537916 1:3187913-3187935 ACGGGCAGCCCCTGTGGAACGGG + Intronic
900574211 1:3375018-3375040 CGGGGTGGGCTCTGAGGAACTGG - Intronic
901465365 1:9417802-9417824 CAGGACAGCCTCTGGGGCCCCGG + Intergenic
901700951 1:11044580-11044602 GGGCTCAGCCTCTGGGGACCTGG + Intronic
901758786 1:11457325-11457347 CAGGGCACTCTCTAGGGAACAGG + Intergenic
901822998 1:11842205-11842227 CGGGGCAGCCTCAGGGCAGGCGG - Exonic
901934619 1:12618803-12618825 GGGGGAAGCCGCTGGGGAGCAGG + Intergenic
902552928 1:17229979-17230001 CTGTGCAGCCTCTGGGGTACAGG - Intronic
903224726 1:21888040-21888062 CCGTGCAGGCTCTTGGGAACTGG + Exonic
903372643 1:22846847-22846869 TGGGGAAGCCTGTGGGGAAGAGG - Intronic
903743369 1:25571261-25571283 AAGGGCAGCCACTGGGGAAGAGG - Intergenic
904304306 1:29577678-29577700 GCGGGCAGCCTCTGTGGGACTGG + Intergenic
904697462 1:32338251-32338273 CAGGGCATCCCCTGGGGACCAGG - Intergenic
904775583 1:32904113-32904135 CGGGGCAGCCCCTGGGAGATGGG - Intergenic
905107477 1:35573195-35573217 TGTGGCAGCCGCTGGGGAAAAGG + Intergenic
907050478 1:51326763-51326785 AGGGGCAGCCTGTGGAGAAATGG - Intronic
910231993 1:84997153-84997175 CGGGGCAGCCCCTTGGGGGCGGG - Intergenic
915110911 1:153564228-153564250 CTGCGCAGGCTCTGGGGAGCAGG + Intronic
915271778 1:154758717-154758739 CAGCTCAGCCTCTGGGGGACTGG + Intronic
915348251 1:155208926-155208948 CGCGGCAGGCTCTGGAGAGCGGG - Exonic
917721470 1:177790508-177790530 TTGGGCAGCCACTTGGGAACGGG - Intergenic
917853228 1:179082529-179082551 GGGGGCAGCCTCCGCGGAGCAGG + Intronic
919990991 1:202708788-202708810 CGGGCCCGCCTTTGGGGCACTGG + Intronic
1064094966 10:12417518-12417540 GAGGGCAGCCTCTGGGGCTCCGG + Intronic
1064347960 10:14549636-14549658 CAGGGCAGCCTGTGGGAAAATGG - Intronic
1067018301 10:42773685-42773707 GGGGGCAGCCACTGGGAAATGGG - Intergenic
1067731371 10:48814089-48814111 CGGGGCAGCATGTGGGGAATGGG - Intronic
1067790884 10:49286856-49286878 CAGGGCATCCTGTGGGGAGCTGG + Intergenic
1068689914 10:59905276-59905298 CTGGGCAGCCTCCAGGGGACAGG + Intronic
1069918667 10:71802835-71802857 TGGGGCAGCCTCAGCGGACCTGG - Intronic
1070089050 10:73266307-73266329 CAGGGCAGTCATTGGGGAACAGG - Intronic
1070115606 10:73526007-73526029 AGGGACAGCCTCTTGGGAAATGG - Intronic
1070734159 10:78852105-78852127 TGGAGCAGCCTCTGGGGATAAGG - Intergenic
1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG + Intergenic
1071293013 10:84200948-84200970 TGTGGCAGCCCCTGGGGAAAGGG - Intronic
1073525828 10:104181154-104181176 TGGGGCAGACTCTGGGGGAAGGG - Intronic
1074122476 10:110503117-110503139 CTTGGCAGCTTCTGGGGAAAAGG + Intronic
1074360678 10:112822189-112822211 CGGGGCAACCTCCAGGGAGCTGG - Intergenic
1074752652 10:116601643-116601665 CGAGGCAGCCCCTGGGCATCAGG - Intronic
1074777569 10:116777483-116777505 AGTGGCAGGCTCTTGGGAACTGG - Intergenic
1074883884 10:117679768-117679790 GGGGCCAGCCTCTGGGGAAATGG + Intergenic
1075709814 10:124525017-124525039 CGGGGCCGCCTCTGCAGGACTGG - Intronic
1076640694 10:131914781-131914803 CGGGGGTGCCTGTGGGGAAAGGG + Intronic
1077059410 11:611250-611272 AGGGGCAGCCACAGGCGAACAGG - Intronic
1077161078 11:1113169-1113191 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161098 11:1113215-1113237 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161118 11:1113261-1113283 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161158 11:1113353-1113375 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161178 11:1113399-1113421 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077222207 11:1422729-1422751 CTCGGCTGCCTGTGGGGAACTGG + Intronic
1077298591 11:1837280-1837302 CGGGGCAGCCCCTGCAGCACTGG + Exonic
1077364330 11:2155448-2155470 AGGGGCAGCCTCGGGGACACTGG + Intronic
1077503695 11:2920558-2920580 CGGGGCACCCTCGCAGGAACTGG + Intronic
1078019001 11:7640019-7640041 AGGGGGAGCCTCTGGGGAGGTGG - Intronic
1078191048 11:9092301-9092323 CAGGGCAGCCTAAGGGGAAGGGG + Intronic
1081771364 11:45652172-45652194 CGGGGCAGACTGTGAGGCACAGG - Intronic
1084113494 11:67028388-67028410 GGGGGCAGCATCAGGAGAACTGG + Intronic
1084653039 11:70500149-70500171 CAGGGCAGCCTCTTGGGGAATGG + Intronic
1085316931 11:75550960-75550982 CCGGGAAGGCTCTGGGGAGCAGG - Intergenic
1085400077 11:76230590-76230612 AGGGTCAGCCCCTGGGGAGCAGG + Intergenic
1087141379 11:94768661-94768683 GGGGGCAGCTTCTGGGGGCCCGG + Intronic
1089448406 11:118572477-118572499 AGGGGTAGGGTCTGGGGAACGGG - Exonic
1090225885 11:125072040-125072062 CTAGGGAGCCACTGGGGAACCGG + Intronic
1091385956 12:94746-94768 GGAGGAAGCCTCTGGGAAACAGG + Intronic
1091450268 12:568545-568567 AGGGGCAGCCTGCGGGGCACAGG - Intronic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1092023435 12:5221638-5221660 CGTGGGAGCATCTGGGGAGCCGG + Intergenic
1092940782 12:13405187-13405209 CAGAGCAGCCTCTGGGCACCAGG + Intergenic
1099996357 12:89783663-89783685 AGGGGCAGCCTCTGTGGAAGGGG + Intergenic
1102426769 12:112849928-112849950 CTGGGCTGCCTCTGGGGGTCAGG + Intronic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103433380 12:120906091-120906113 CTGGGCAGGCCCTGGGAAACTGG - Intergenic
1103506036 12:121442856-121442878 CGCGTCAGCCTCTGGGGCTCAGG + Intronic
1103557383 12:121774845-121774867 CGGGGCAGCCTCTGGGCCCAGGG + Intronic
1103700709 12:122847503-122847525 AGGGGCAGCCTATGGGGCAGTGG + Intronic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104732610 12:131116313-131116335 CCAGGCAGCCTCTGTGGAAGAGG - Intronic
1104902682 12:132197772-132197794 CAGGTCAGCCTCTGGGGAAGGGG - Exonic
1104921857 12:132294708-132294730 CGGGGCAGCCTCTGGGAGGGCGG + Intronic
1104970719 12:132529471-132529493 AAGGGCAGCCTCAGGGGAGCTGG - Intronic
1106386179 13:29288376-29288398 CGGGGCAGCAGCTGAGGAAATGG + Intronic
1108408460 13:50125990-50126012 CGGGGCGGCGACTGGGGAGCCGG - Intronic
1112660478 13:101501957-101501979 GAGGGAAGCCTCTGGGGAAAAGG - Intronic
1113963906 13:114141028-114141050 CAGGTGAGCCTCAGGGGAACTGG + Intergenic
1114417054 14:22551902-22551924 GGAGGCAGTCTCTGGGGAGCAGG - Intergenic
1114654561 14:24308322-24308344 CGGGGCAGAGTGTGGGGAAGTGG + Exonic
1116262660 14:42651728-42651750 CTGGGAATCCTCTGAGGAACTGG + Intergenic
1118683718 14:68269742-68269764 CTGAGCAACCGCTGGGGAACAGG - Intronic
1118760815 14:68879367-68879389 GGGGGAAGCCCCTGGGGAAGCGG - Intronic
1118827723 14:69398936-69398958 CGGGGCCGCCTCTTGGAGACAGG + Exonic
1118839514 14:69500384-69500406 TGGGGCAGGGTCTGGGGCACAGG - Intronic
1119032390 14:71202900-71202922 CGGGGTAACATCTGGGGAAGGGG + Intergenic
1121716672 14:96081092-96081114 CGTGGCTGCCTCTGGGAAAGGGG - Intronic
1121950430 14:98166855-98166877 CGGGGCTGGCTCTGAGGCACTGG + Intergenic
1123121721 14:105919821-105919843 AGGGGCAGCCTATGAGGATCTGG - Intronic
1123404426 15:20011472-20011494 AGGGGCAGCCTGTGAGGATCTGG - Intergenic
1123513759 15:21018119-21018141 AGGGGCAGCCTGTGAGGATCTGG - Intergenic
1124344507 15:28913298-28913320 CGGGGCAGCATCTGGAGGCCTGG + Intronic
1125181960 15:36888222-36888244 CCGGGCAGACTCTGGGTGACAGG - Intergenic
1127376855 15:58392935-58392957 CAGGGCTGCCTTTGGGGAAAGGG + Intronic
1127614319 15:60668492-60668514 CTGGGCAGCCTCTGGGTCCCTGG - Intronic
1127953605 15:63833874-63833896 CGCCGCAGCCTCTGCGGAGCCGG - Exonic
1128643551 15:69358484-69358506 AGGGGCAGCCTCTGGTGGAGTGG + Intronic
1129108260 15:73323273-73323295 CTGGGCAGCCTGCGGGGAGCGGG + Exonic
1130520538 15:84657995-84658017 CGAGGCAACCTCTGGGCCACCGG - Exonic
1130954361 15:88616418-88616440 AGGGGCAGCCTCTGGGTAGAAGG + Intergenic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131452897 15:92560972-92560994 AGGGTCTGCTTCTGGGGAACTGG - Intergenic
1132327444 15:100983545-100983567 CCCGGCAGCCTATGGGGATCTGG + Exonic
1132393128 15:101453333-101453355 AGGGGCAGCCTGCGGGGAGCAGG - Intronic
1132451786 15:101972746-101972768 CTGGGCAGCCTCAGAGGCACGGG - Intergenic
1132455107 16:17883-17905 CTGGGCAGCCTCAGAGGCACGGG + Intronic
1132552723 16:560079-560101 CGCGGCAGCCTGCGGGCAACGGG + Intergenic
1132978417 16:2721575-2721597 CTGGGCAGCCCCTGGGGGTCTGG + Intergenic
1133303255 16:4795687-4795709 TGATGCAGCCTCTGGGGGACCGG + Intronic
1133338327 16:5020920-5020942 AGAGGCAGCCTCTGGGCCACAGG - Intergenic
1134202717 16:12212147-12212169 TGGGGCAGCCTCTGTGTGACTGG + Intronic
1138336629 16:56258622-56258644 CAGGGAAGCTGCTGGGGAACAGG - Intronic
1138548569 16:57734877-57734899 TGGGACAACCTCTGGGCAACAGG + Intergenic
1139371360 16:66471396-66471418 CGGGGCAGCCTGTGGGTGCCAGG - Intronic
1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG + Intergenic
1140469216 16:75205299-75205321 CGGGGCTGCCTCTGGGGTCTGGG - Intronic
1140472568 16:75223640-75223662 CGGGGCTGCCTCTGGGGTCTGGG + Intronic
1140574330 16:76147940-76147962 GTGGGCAGCCTCTGGGAAGCGGG + Intergenic
1141132232 16:81444585-81444607 AGGGGCAGCCCCTGGGGAGGGGG - Intergenic
1141699028 16:85634017-85634039 CGGGGCTGCCGCTGGGCACCAGG - Exonic
1142981739 17:3676393-3676415 ACTGGCTGCCTCTGGGGAACCGG + Intronic
1143267710 17:5652867-5652889 CTAGGCAGCCTCTGGGAAGCTGG + Intergenic
1143733431 17:8894252-8894274 CGGGGCAGCCTCCTGGGCCCAGG - Intronic
1144211270 17:13017638-13017660 CGGCGCAGCCTCTGAGCATCGGG - Intronic
1144955273 17:19015872-19015894 CGGGGCTGTGTCTGGAGAACAGG + Intronic
1145234070 17:21196423-21196445 CGTGGCAGTCTCTGGGCACCTGG - Intergenic
1145901166 17:28491379-28491401 CAGGGCCAGCTCTGGGGAACGGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1147605061 17:41769718-41769740 CTGGGCAGACACTGGGGAGCAGG + Intronic
1148158324 17:45436101-45436123 ACTGGCAGCTTCTGGGGAACGGG + Exonic
1148271633 17:46266500-46266522 AGGGGCAGCCTTTGGGGAAACGG - Intergenic
1148772226 17:50074100-50074122 GGGGGCAGGCTCTGGGGAGCAGG - Intronic
1149083999 17:52692557-52692579 TGGGGAACCCTCTGAGGAACTGG + Intergenic
1150765148 17:67996302-67996324 AGGGGCAGCCTTTGGGGAAACGG + Intergenic
1151358352 17:73573440-73573462 TGGAGAAGCCTCTGGGGAACTGG - Intronic
1151666765 17:75549686-75549708 CTGGGCAGCCTCTGAGGGCCTGG + Intronic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1152027360 17:77819740-77819762 AGGGGGAGGTTCTGGGGAACTGG + Intergenic
1152449138 17:80365394-80365416 CGTGCCAGCCTCCGGGGAGCTGG - Intronic
1155876919 18:31100883-31100905 GGGAGCAGCGTCTGGGGAATTGG - Intronic
1156149622 18:34225433-34225455 CGGGGTGGCCTCTGGAGAAGGGG - Intergenic
1156499641 18:37549406-37549428 CGGGGCAGCCCCTGGCCAAAGGG - Intronic
1156521208 18:37723708-37723730 AGGGGCAGCCTCAGGAGACCCGG + Intergenic
1157804527 18:50648341-50648363 GGGGGCAGCCTCTGGAGAGTGGG + Intronic
1158454389 18:57593527-57593549 CGGGGCGGCTGCTGGGGGACAGG + Intergenic
1158721440 18:59928700-59928722 CAGGGCAAACTATGGGGAACGGG + Intergenic
1158865746 18:61636321-61636343 CTAAGCAGCCTCTGGGGAAGGGG + Intergenic
1160838752 19:1136972-1136994 GGGGGCAGCACCTGGGGAATGGG + Intronic
1161102618 19:2428831-2428853 CTGGGCAGCCTGTGGGTAATTGG - Exonic
1161103442 19:2432503-2432525 AGGATCAGTCTCTGGGGAACTGG - Exonic
1162479824 19:10921676-10921698 CGGGGCCGCCCATGGTGAACTGG - Exonic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1163235089 19:16025277-16025299 AGGGACAGCCTGTGGGGAGCAGG - Intergenic
1163678244 19:18666151-18666173 CGGGGCAGGGTCTGGGGAGCTGG + Intronic
1164756597 19:30694553-30694575 GGAGGCAGCCGCTGGGGAGCTGG - Intronic
1164949645 19:32326462-32326484 GGGGGCTGCCACTGGGGGACAGG + Intergenic
1166298005 19:41898007-41898029 CGGGGCAGCCTCGGGGCTAAGGG + Intronic
1166325995 19:42051516-42051538 CGGGGCAGCAGGTGGGGAAGGGG - Intronic
1166337378 19:42116684-42116706 AAGGGCAGCCACTGGGGACCAGG - Intronic
1166500499 19:43337614-43337636 CAGGGCAGGCCCTGGGGAAGGGG + Intergenic
1166509625 19:43396085-43396107 CAGGGCAGGCCCTGGGGAAGGGG - Intergenic
1167159205 19:47756402-47756424 CAGGGCAGCCTGTGGGCACCAGG - Intronic
925373179 2:3362236-3362258 TGGGGCAGGCTGTGGGGAAGGGG - Intronic
926434866 2:12827546-12827568 AGGGGCAGGCTTTGGGGATCCGG + Intergenic
927202093 2:20584215-20584237 CAGCACAGCCTCTGGGAAACTGG - Intronic
928245074 2:29619859-29619881 GGAGGCAGCCCCTGGGGCACTGG + Intronic
932883121 2:75522831-75522853 CAGGCCAGCCTCTCTGGAACAGG + Intronic
933319693 2:80757907-80757929 CTGAGCAGCTTCTGGGGAAGGGG - Intergenic
933368846 2:81389661-81389683 AGGGGCATCATGTGGGGAACAGG - Intergenic
934649839 2:96084604-96084626 AGGGGCAGCCTCTGGCCAGCAGG + Intergenic
934710191 2:96509327-96509349 ACGGGAAGCCTCTGGGGAGCTGG + Intergenic
936567997 2:113595213-113595235 CTGGGCAGCCTCAGAGGCACGGG - Intergenic
937227549 2:120378456-120378478 GGGGGTAGGCTCTGGGTAACTGG + Intergenic
938804028 2:134789397-134789419 AGGGTCAGCCTCTGGGGACAGGG + Intergenic
941266964 2:163374493-163374515 CAGGGCAGCCTCTGCAGAATAGG - Intergenic
944087829 2:195869734-195869756 GGAGGCAGCCTGAGGGGAACAGG + Intronic
946193244 2:218018679-218018701 CTGGGAAGCAACTGGGGAACAGG + Intergenic
947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG + Intronic
948038761 2:234881849-234881871 CTGATCAGCCTCTGGGGAAGTGG - Intergenic
948232934 2:236365357-236365379 TGGGCCAGCCTCTGAGGAATGGG + Intronic
1169673903 20:8132862-8132884 AGGGGCAGCCTCGGGCGCACAGG + Intronic
1170572073 20:17638091-17638113 CTGGGAAGCCCCTGGGGAAAGGG + Intronic
1170692133 20:18625464-18625486 TGGCCCAGCCTCTGGGGCACTGG + Intronic
1171089172 20:22267898-22267920 CGGGGCAGGTCCTGGGGAAGTGG - Intergenic
1174772006 20:53308933-53308955 CGGGGCAGCAGTTGGGGAAGAGG + Intronic
1175698961 20:61123633-61123655 CAGGGCAGCCTCTGCGGGACTGG - Intergenic
1175875776 20:62228539-62228561 CAGGGCAGCTCCTGGGGACCTGG + Intergenic
1175953409 20:62595908-62595930 TGGGGCGGCCTCTCGGGAGCAGG - Intergenic
1175972453 20:62693567-62693589 AGGGGCTGCTTCTGGGGAACCGG - Intergenic
1176121552 20:63456409-63456431 GGAGTCAGCCTCTGGGGAAGGGG - Intronic
1179557347 21:42188162-42188184 CGGGGCAGTCACTTGGTAACAGG + Intergenic
1179644875 21:42769867-42769889 CGGGCCAGGCTGTGGGGAGCAGG - Intronic
1180014881 21:45075199-45075221 CGGGGCAGCCTCTGGTCCCCGGG - Intronic
1180132573 21:45835876-45835898 CACGGCAGCCCCAGGGGAACAGG + Intronic
1180693921 22:17739846-17739868 CTGGGCAGCCGTTGGGGAAGGGG + Intronic
1180757318 22:18171016-18171038 GGGGACAGTCTCTGAGGAACAGG - Intronic
1181074461 22:20366449-20366471 GGGGACAGTCTCTGAGGAACAGG + Intronic
1182317006 22:29454361-29454383 CAGGGAAGCCTCTGAGGGACAGG - Intergenic
1182529356 22:30943528-30943550 GGGAGGAGCCTCTGGGGAAGTGG - Intronic
1183197140 22:36361297-36361319 TGGGGCAGGCTCTGGGGCCCGGG - Intronic
1183313566 22:37124835-37124857 CCGGGCAGCCGCTGGGGCCCTGG - Intergenic
1183397646 22:37581653-37581675 CCGGGCAGGATGTGGGGAACTGG + Intronic
1183469431 22:37997747-37997769 CGGGGCAGTCTCAGGGAAGCTGG - Intronic
1183745836 22:39691196-39691218 AGGGGCAGCCTGAGGGGAACAGG - Intergenic
1183750453 22:39717138-39717160 CGTGGCTACCTCTGGGGAAGGGG - Intergenic
1183856255 22:40636891-40636913 CGGCGCAGCCAATGGGCAACGGG + Intergenic
1184365403 22:44047921-44047943 CGGGGCTGACTCAGGGGAGCCGG - Intronic
1184518266 22:44976597-44976619 AGTTGCAGCCTCTGGGGAGCTGG + Intronic
1184693612 22:46128287-46128309 CTGGGCAGCATCTTGAGAACAGG + Intergenic
1184943222 22:47783669-47783691 CTGGGCAGCCTCTGTGCACCTGG - Intergenic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
949890245 3:8728408-8728430 TGGAGCAGGCTCTGGGGAAGGGG - Intronic
950316219 3:12004286-12004308 CGGGGCCGCCTCTGCGGCGCGGG + Intergenic
950660637 3:14464826-14464848 CTGGGCCGCATCTGGGGATCAGG - Intronic
951527113 3:23664160-23664182 TGCTGCAGCCTTTGGGGAACAGG + Intergenic
952901168 3:38112517-38112539 TGAGGCAGCCTCTGGGGTTCTGG + Intronic
953584197 3:44185097-44185119 CTGGGCAGCTTCTGGGGCAAAGG + Intergenic
954413815 3:50383205-50383227 GCGGGCAGCCTGTGGGGAGCAGG + Intronic
954429503 3:50462735-50462757 AGTGACAGCCTCTGGGGAGCTGG + Intronic
954522651 3:51243000-51243022 CAGGGCAGCCTCAGGTGACCTGG - Intronic
954580065 3:51698467-51698489 CGGGGCAGGCTCTGAGTAAGAGG + Intronic
956742418 3:72285755-72285777 GGGGGGAGCCTGTGGGGAACTGG - Intergenic
961830329 3:129619867-129619889 CAGGGGAGTCTCTGGGGACCAGG + Intergenic
962736458 3:138329661-138329683 CGGTGCAGCCTGTCGGGCACAGG + Intronic
968495424 4:912640-912662 CGGAGCAGCCTCTTGGCCACTGG + Intronic
968945158 4:3659823-3659845 CAGGGAAGCCACTGGGGACCTGG - Intergenic
970202840 4:13627362-13627384 CCAGGCAGTCTCTGCGGAACTGG + Exonic
970545706 4:17128049-17128071 TGGGGCAGCCTCAGGCAAACCGG + Intergenic
975093114 4:70426205-70426227 TGTGGCAGCCTCTGGGAAAATGG - Intergenic
977845454 4:101761769-101761791 CTGGGCAGAATCTGGGGAAGGGG - Intronic
981288439 4:143046643-143046665 CTAGGGAGCCTCTGAGGAACTGG - Intergenic
981748671 4:148073437-148073459 CAGAGCAGCCTCTGGGGCATGGG - Intergenic
985605780 5:857478-857500 CGGGACAGACTCTGGGGGCCTGG - Intronic
985605816 5:857617-857639 CGGGACAGACTCTGGGGGCCTGG - Intronic
985605970 5:858232-858254 CAGGACAGACTCTGGGGATCTGG - Intronic
985674339 5:1223057-1223079 CGGAGCAGCCTCTCGGAAGCCGG + Exonic
985761432 5:1751279-1751301 CAGGGCAGTCTCTGGGGGGCTGG - Intergenic
986326835 5:6682143-6682165 CAGGGCAGCCTCAGAGGAGCAGG + Intergenic
986721191 5:10563019-10563041 TGGCGCAGCCGCTGGGGACCAGG - Intergenic
988348360 5:30069637-30069659 CAGGGCAGCCTCTGGTGCCCTGG + Intergenic
990990296 5:61677489-61677511 CAGAGCATCATCTGGGGAACTGG - Intronic
995105414 5:108372001-108372023 CAAGGCAACCCCTGGGGAACAGG - Intronic
996878260 5:128263534-128263556 CGTGGCAGGCACTGGAGAACTGG + Exonic
997697493 5:135873080-135873102 CAGGGCAGCACCTGGGGAAGTGG + Intronic
998407682 5:141883216-141883238 CTGGGCAGCCCCCGGGGACCCGG + Intergenic
999049601 5:148508082-148508104 CTGAGCAGCCTCTGAGGCACAGG + Intronic
999052876 5:148542851-148542873 CTGGCCAGCCTAAGGGGAACTGG + Intronic
1002402152 5:178996781-178996803 GGGGGCAGCAGCTGGGGGACTGG + Intergenic
1002691539 5:181053608-181053630 CAGGGCGGCCACCGGGGAACGGG + Intronic
1003511940 6:6789004-6789026 AGTGGCTGCCTCTGGGGAGCAGG + Intergenic
1004540085 6:16541479-16541501 CAGGGCAACCTCTGGTGACCTGG + Intronic
1006079726 6:31558336-31558358 AGGGGCAGCCTCTGGCGATTTGG + Exonic
1006615084 6:35320870-35320892 CTGGGCAGCCTGTGGGGACAGGG - Exonic
1006679693 6:35788080-35788102 TGGTGGAGGCTCTGGGGAACAGG - Exonic
1007629086 6:43262903-43262925 CGTGTCAGCCTCTGTGGAGCAGG + Exonic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1017913838 6:158817985-158818007 TGGGGCAGTTCCTGGGGAACAGG - Intronic
1018423769 6:163662479-163662501 CACTGCAGCCTCTGGGGACCGGG + Intergenic
1019179554 6:170177788-170177810 TGAGGCAGCCTCTGGGGCTCGGG + Intergenic
1019248280 6:170724218-170724240 CAGTGCAGCCTCTGGGGTCCTGG + Intergenic
1019648786 7:2145069-2145091 CGGGGCAGCCTACAGGGCACTGG - Intronic
1019764879 7:2843292-2843314 CGGGCCAGCTTCTGGGGATGGGG - Intronic
1020114847 7:5470643-5470665 CGGAGAAGCCTCTGCGGAAGGGG - Intronic
1020208633 7:6140321-6140343 CGAGGCTGCCTCTGGGTAAAAGG - Intronic
1024224513 7:47315349-47315371 CGGGGCAGCCCCCCGGGACCGGG + Intronic
1030057230 7:105594003-105594025 TGGGGAAGCCTCTTGGGAAAGGG - Intronic
1032079106 7:128849835-128849857 CAGGGCAGCCTCTGGGGAGATGG - Intronic
1033337430 7:140465508-140465530 CTGGACACCCTCTGGGGAAAGGG - Intronic
1034269709 7:149797647-149797669 CCGGGAAGCCCCTGGGGACCCGG - Intergenic
1034813000 7:154149256-154149278 TTGGGCAGCCTCTGGGGCATGGG - Intronic
1034982805 7:155489563-155489585 CTGGGAAGCCTCAGGGAAACTGG + Intronic
1035072830 7:156157524-156157546 GGAGGCAGCCTCTGGAGAGCCGG + Intergenic
1035370897 7:158378322-158378344 TGGGGAAGCCTCTGGGCAGCAGG - Intronic
1035573207 8:687793-687815 CGGGGCAGCCACGGAGGAATCGG + Intronic
1036165462 8:6428841-6428863 AGGAGCTGCCTCTGGGGAACAGG - Intronic
1047037449 8:120955342-120955364 CGGGGCAGCATCCTGGGGACAGG - Intergenic
1048210098 8:132447726-132447748 CGAGACTGCCTCTGGGGAAGGGG + Intronic
1049711985 8:144068916-144068938 TGGGGCAGCATCTGTGGACCTGG - Intergenic
1049884533 9:18307-18329 CTGGGCAGCCTCAGAGGCACGGG + Intergenic
1051358869 9:16264466-16264488 CGGGGCATCTTCTGGGCCACTGG - Intronic
1051819691 9:21149976-21149998 TGGAGCAGCTTCTGGGGAAGGGG - Intergenic
1054808301 9:69413290-69413312 GTGGGCAGCCTCCGGGGAGCAGG - Intergenic
1057024595 9:91725451-91725473 CGGGGCAGCCCCAGGGCAGCTGG - Intronic
1057228832 9:93306601-93306623 CGGGGCAGCCCCTGGAGAGAGGG - Intronic
1057976332 9:99609697-99609719 AGGGGCAGCCTCAGAGGACCTGG + Intergenic
1058736600 9:107899724-107899746 CAGGGCAGCCTGAGGGGAATAGG + Intergenic
1058984878 9:110201137-110201159 CTGGGCAGCCTCTGGGATTCCGG + Exonic
1060587439 9:124795284-124795306 GGGTCCAGCCTCTGGGGAAGAGG + Intronic
1060981199 9:127793290-127793312 TGGGGTAGACTCTGGGGAAGAGG - Intergenic
1061378684 9:130241337-130241359 CAGGGCAGCCCCTGAGGACCGGG + Intergenic
1061790606 9:133057086-133057108 TGAGGCAGCCTCTGGGCAGCTGG - Intronic
1061924420 9:133798946-133798968 CAGGGCAGGCTCTTGGGACCAGG + Intronic
1061975348 9:134065628-134065650 CGGGGCGGGGTATGGGGAACCGG - Intronic
1062349745 9:136133054-136133076 CGGGGCAGGCTCTGGGGCGCGGG - Intergenic
1186481096 X:9896327-9896349 TGGGCAGGCCTCTGGGGAACAGG - Exonic
1189056154 X:37701485-37701507 CTGGGCAGCATCTGGCCAACAGG - Intronic
1197886367 X:131222323-131222345 CGGGGCGGCATGTGGGGAAGGGG - Intergenic
1200063380 X:153493707-153493729 CTGGGCTGCCGCTGGTGAACAGG + Intronic