ID: 1185288521

View in Genome Browser
Species Human (GRCh38)
Location 22:50012976-50012998
Sequence TGCACCAGTGGCCGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185288521_1185288532 14 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288532 22:50013013-50013035 CCGGCGGGATAGGCTGCCGCCGG No data
1185288521_1185288527 -2 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288527 22:50012997-50013019 CAGAGATGGCTCCAGGCCGGCGG No data
1185288521_1185288529 4 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288529 22:50013003-50013025 TGGCTCCAGGCCGGCGGGATAGG No data
1185288521_1185288525 -9 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288525 22:50012990-50013012 ACTGGTGCAGAGATGGCTCCAGG No data
1185288521_1185288528 -1 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288528 22:50012998-50013020 AGAGATGGCTCCAGGCCGGCGGG No data
1185288521_1185288526 -5 Left 1185288521 22:50012976-50012998 CCCACAGGGCGGCCACTGGTGCA No data
Right 1185288526 22:50012994-50013016 GTGCAGAGATGGCTCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185288521 Original CRISPR TGCACCAGTGGCCGCCCTGT GGG (reversed) Intergenic