ID: 1185290021

View in Genome Browser
Species Human (GRCh38)
Location 22:50019193-50019215
Sequence GAGGTTACAGACTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185290021_1185290022 -8 Left 1185290021 22:50019193-50019215 CCAGAAACAGAGTCTGTAACCTC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1185290022 22:50019208-50019230 GTAACCTCCAAACCAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185290021 Original CRISPR GAGGTTACAGACTCTGTTTC TGG (reversed) Intronic
901347971 1:8564216-8564238 GAGGTTACTCAGTCTGTATCTGG - Intronic
905476992 1:38235982-38236004 GAGGTTACAGGATATTTTTCTGG - Intergenic
907009122 1:50946382-50946404 GTGGTTACAGACTGAGTTCCAGG - Intronic
907568910 1:55465070-55465092 GAGGTAACTGACTTTCTTTCAGG + Intergenic
908991106 1:70090858-70090880 GGTGTTAAAGGCTCTGTTTCGGG - Intronic
909346845 1:74599781-74599803 GAGGTTTCACTCTCTTTTTCAGG + Exonic
910532605 1:88257054-88257076 GAGGTTAAAAACTCTGCTTGGGG - Intergenic
912198598 1:107429176-107429198 GAAGTTGCTGACACTGTTTCTGG + Intronic
914329052 1:146648961-146648983 GACTTTACAGAATCTGTTTATGG + Intergenic
914738722 1:150444914-150444936 GAGATTACAGGCACTGTGTCTGG - Intronic
916240596 1:162635001-162635023 GAGGCCTCAGCCTCTGTTTCTGG + Intronic
917077137 1:171217525-171217547 GAGGTTACAAACTGTTTTTTGGG - Intergenic
917523606 1:175768160-175768182 GAGGTTGCAGACCCTGTTTATGG - Intergenic
919666963 1:200301633-200301655 GAGGGTTCAGACCCTGTCTCTGG - Intergenic
922245840 1:223796473-223796495 GAAGAAACAGGCTCTGTTTCAGG + Exonic
922629931 1:227096446-227096468 GTAGTTACAGAATCTGTTTCAGG - Intronic
1063025325 10:2172752-2172774 AACGTTACAGGCTCTGTTCCCGG - Intergenic
1066545603 10:36497066-36497088 GAGGTTACAAAATATGTTTAAGG - Intergenic
1066847625 10:40045547-40045569 GAGTTGAAACACTCTGTTTCTGG + Intergenic
1066861763 10:40326362-40326384 GAGGTGAAACACTCTTTTTCTGG + Intergenic
1066883326 10:40753576-40753598 GAGTTGAAACACTCTGTTTCTGG + Intergenic
1066886165 10:40809614-40809636 GAGTTGAAACACTCTGTTTCTGG + Intergenic
1069060300 10:63887852-63887874 AAGTGTACAGACTCTGTTTCTGG + Intergenic
1069919356 10:71807208-71807230 GAGCTTCCAGTCCCTGTTTCAGG - Intronic
1073290681 10:102411857-102411879 GAGTTTCCAGCCTCTGTCTCTGG + Intronic
1074792195 10:116901474-116901496 GATGATACAGACTCTGCGTCAGG - Intronic
1077497404 11:2892763-2892785 GAGGCTGCAGCCTCTGTGTCGGG + Intronic
1078081600 11:8208215-8208237 GAGCATACAGACTCTGTGTAAGG - Intergenic
1078736701 11:14026903-14026925 GAGATGACAGCCTTTGTTTCTGG - Intronic
1079222878 11:18579382-18579404 GAGATTAAAGACTCTGGTCCTGG - Intronic
1080940558 11:36913371-36913393 GAGTTTACATATTTTGTTTCTGG - Intergenic
1083248622 11:61450163-61450185 GAGGTTAAATAATGTGTTTCAGG - Intronic
1083333715 11:61911170-61911192 GATGTCACAGACTCTGTCACAGG - Intronic
1087285118 11:96256646-96256668 GAGGTTAGGAACTGTGTTTCTGG + Intronic
1087800268 11:102496161-102496183 GAGCTTTCAGACTCTGATGCAGG + Intronic
1088316448 11:108511706-108511728 GAGGTTACAGAATTTTTTGCTGG + Exonic
1090849644 11:130561079-130561101 GAGGTGACAGACACTGGTACAGG + Intergenic
1091261733 11:134239834-134239856 GAAGTTACAGACCCTCTTCCAGG - Intronic
1091667081 12:2426991-2427013 GAGGAAATAGACTCTGATTCTGG + Intronic
1092085079 12:5750345-5750367 GAAGGCACAGCCTCTGTTTCAGG - Intronic
1092500344 12:9039666-9039688 GAGATTACAGATTCTCTTCCAGG + Intergenic
1092607546 12:10136802-10136824 GAGGTTTCAGACTCTGGACCTGG - Intergenic
1094885162 12:34859671-34859693 GAGGTTAAAGACCCTTTTTGTGG + Intergenic
1094909321 12:35250972-35250994 GAGGTTAAAGACCCTTTTTGTGG + Intergenic
1095048745 12:37538389-37538411 GAGGTTGAAAACACTGTTTCTGG - Intergenic
1095245424 12:39914973-39914995 CAGGTTATAGACTTAGTTTCAGG + Intronic
1102192763 12:111001521-111001543 GAGAGCACAGACTCTGGTTCAGG + Intergenic
1102796449 12:115692987-115693009 GAGGGAAGAGAATCTGTTTCAGG + Intergenic
1106015871 13:25868592-25868614 GAAGTAACACACTGTGTTTCTGG + Intronic
1107928248 13:45285120-45285142 GAGGAGACACAGTCTGTTTCAGG - Intergenic
1108271264 13:48761837-48761859 GAGGTTAAATAATCTGATTCCGG + Intergenic
1108641009 13:52382311-52382333 GAGGATTCAGACTCTGTATGTGG - Intronic
1109734656 13:66466976-66466998 CTAGTTACTGACTCTGTTTCAGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1115391370 14:32857979-32858001 GTGGTTACACACTTGGTTTCTGG - Intergenic
1116429346 14:44828027-44828049 GTGTTTACAGACTGTGTTTCTGG + Intergenic
1117628176 14:57662066-57662088 GATGTCAGAGACTGTGTTTCCGG + Intronic
1118828406 14:69405969-69405991 GAGGTCACAGACTCTGGTAGAGG + Intronic
1119174602 14:72559931-72559953 GAGGTTGGAGATTCTATTTCTGG - Intronic
1119798689 14:77423183-77423205 CAGGTTACAGGCACTGTTTTCGG + Intronic
1122088254 14:99321694-99321716 GAGGTTTCAGGCCCTGTTGCAGG + Intergenic
1127465805 15:59243535-59243557 GAGGTGAGAGAGTCTGTGTCAGG + Intronic
1128738754 15:70069105-70069127 GAAGACACAGTCTCTGTTTCTGG - Intronic
1131166032 15:90142784-90142806 GAGGCTACAGACACTGTTCCTGG - Intergenic
1133281627 16:4669658-4669680 GGAGTTGCAGACTTTGTTTCTGG - Intronic
1134771868 16:16816109-16816131 TAGGTGAAGGACTCTGTTTCAGG - Intergenic
1137912573 16:52393075-52393097 TAGGTTACAGATTCTGCTTGGGG - Intergenic
1140004514 16:71061982-71062004 GACTTTACAGAATCTGTTTATGG - Intronic
1143981666 17:10875398-10875420 GGGGTTGCAGATGCTGTTTCTGG - Intergenic
1144419132 17:15079991-15080013 GAGGTAACATATTCTGATTCGGG + Intergenic
1146630428 17:34465536-34465558 GGAGATACAGACTCTCTTTCTGG - Intergenic
1148557178 17:48585558-48585580 GATGTTACAGCCTCTGCCTCTGG + Intronic
1148777841 17:50105573-50105595 GGGGAGACAGACTCTGCTTCAGG + Intronic
1149068184 17:52505499-52505521 GAGTTTCCAGATTCTGTGTCTGG + Intergenic
1151088937 17:71413053-71413075 GAGTTTACAAAATCTCTTTCTGG - Intergenic
1153234520 18:2972922-2972944 GAGGTGACAGATGCTGTTACAGG + Intronic
1153262048 18:3233825-3233847 GACCATACAGACTCTTTTTCCGG + Intergenic
1153651970 18:7248753-7248775 GAGATTACAGACACTGTACCGGG - Intergenic
1153655684 18:7280155-7280177 GATGTTAAAGAATCTGATTCTGG + Intergenic
1161388394 19:4008651-4008673 GAGGCTACTGATTCTGCTTCAGG + Intronic
1161829686 19:6593296-6593318 GAGGATCCAGCCTCTTTTTCCGG + Intronic
1162336786 19:10066550-10066572 CAGGGTACACTCTCTGTTTCAGG + Intergenic
1164902637 19:31941135-31941157 GAGATCAAAGAGTCTGTTTCAGG - Intergenic
925338651 2:3117428-3117450 GAGGTGACAGGCTCTGATCCAGG + Intergenic
929003863 2:37376514-37376536 GAGGTTTCACTCTCAGTTTCAGG + Intergenic
929940366 2:46329213-46329235 TTGGTTACTGACTCTGGTTCAGG + Intronic
932436319 2:71704388-71704410 GGGGTGACAGAGACTGTTTCTGG + Intergenic
932806533 2:74789110-74789132 GAAGGTACAGACTGTGTTTGAGG - Intergenic
935210771 2:100938088-100938110 GTGGCTACAGATTCTTTTTCTGG + Intronic
935295607 2:101646770-101646792 GGGGTCACTGACTCTATTTCAGG + Intergenic
935299330 2:101680202-101680224 GATGTTACATCCTCTGTTCCAGG + Intergenic
936376722 2:111947436-111947458 GAGGTTGAAGGCTGTGTTTCTGG - Exonic
937736052 2:125291501-125291523 GATATTACAGACTCTCTTTAGGG - Intergenic
938631898 2:133176805-133176827 GTGGTTACAGTCTCTCTTGCAGG + Intronic
939654005 2:144800135-144800157 GAGGTTAAATAATCTTTTTCAGG - Intergenic
940363138 2:152817197-152817219 TTGGTTACGGACACTGTTTCAGG - Intergenic
943116470 2:183678411-183678433 GAGGAAACAGTCTTTGTTTCAGG - Intergenic
944573836 2:201071987-201072009 GAGGTGACAACCTCCGTTTCCGG + Exonic
945953658 2:216064926-216064948 GAGCATACAGACTCTGTCTCTGG + Intronic
946563478 2:220939095-220939117 GTGCTTATAGATTCTGTTTCTGG + Intergenic
947749771 2:232526077-232526099 GAGGTGTCAGATTGTGTTTCCGG + Intronic
1171543262 20:25981868-25981890 GAGGTTGAAAACACTGTTTCTGG - Intergenic
1172000407 20:31771500-31771522 GAGGGTACAGGCTATGCTTCAGG + Intronic
1181902172 22:26165562-26165584 GATGCAACAGACTCTGTCTCTGG - Intergenic
1185290021 22:50019193-50019215 GAGGTTACAGACTCTGTTTCTGG - Intronic
949508394 3:4747385-4747407 GAGGTTACAAACTCACGTTCTGG - Intronic
950155242 3:10716899-10716921 GAGGTTACAGGCTCTGGGACGGG + Intergenic
951493087 3:23294962-23294984 GTGGTTTTAGACTCAGTTTCAGG - Intronic
953332286 3:42063814-42063836 AAGGTTACAGACTCTACATCTGG - Intronic
955168796 3:56542373-56542395 GAGTTTCCAGACTCTGATGCAGG - Intergenic
960638558 3:119807302-119807324 GAGGACACAGAGTCTGTTCCTGG + Exonic
963100909 3:141602960-141602982 GAGGTTACAGATTCCATTTAAGG - Intronic
963336304 3:143977549-143977571 GATGTTCCAGACTTTGTTTCAGG + Intronic
963908660 3:150796019-150796041 GAGCTAACAGACGCTGTGTCAGG - Intergenic
964433284 3:156626667-156626689 GTGGTTAAAGACTTTGGTTCAGG - Intergenic
969382810 4:6817002-6817024 GAGGTTAAAGAACCTGTTTTTGG + Intronic
970027012 4:11634420-11634442 GAGGATACAGAGTGTGTTTGTGG - Intergenic
972120611 4:35696955-35696977 AATGTTTCAGACTTTGTTTCTGG + Intergenic
972794959 4:42406316-42406338 GAAGTTACAGACACTGTCTCAGG + Intergenic
973079200 4:45968655-45968677 ATGGTGCCAGACTCTGTTTCTGG - Intergenic
973733237 4:53844089-53844111 GAGGATACTGACTCTGTTTTTGG + Intronic
976542972 4:86299245-86299267 GAGATTACAGACTTGGTTTTTGG + Intronic
976978446 4:91193135-91193157 GAGGTAAAAGGCTCTGTTTTAGG - Intronic
978137034 4:105275164-105275186 GAGTTGACAGACTCTGTCTGAGG - Exonic
978412765 4:108443113-108443135 GTGGTAACAGACCCTTTTTCTGG - Intergenic
981408879 4:144404399-144404421 GAGACTACAGTCTCTGGTTCAGG - Intergenic
982196954 4:152926024-152926046 GAGGTGCCAGACTCTCTTTTGGG - Intergenic
983054313 4:163083783-163083805 GAGGGTGCAGGCTCTGTGTCAGG + Intergenic
985049025 4:185971281-185971303 GAGGCTACAGACTGGGTTTTAGG + Intergenic
986231497 5:5868310-5868332 CAGGTTGCAGACAGTGTTTCAGG - Intergenic
989049434 5:37304871-37304893 GCAGTTAAAGGCTCTGTTTCTGG + Intronic
995677653 5:114681311-114681333 GAGGGAACAGACTCTGTCTCTGG + Intergenic
999627044 5:153531869-153531891 GAGGTTTCAGTCTCTGTGACTGG - Intronic
999923266 5:156346143-156346165 AAGGTTACAGATACTGCTTCAGG + Intronic
1000361184 5:160449077-160449099 GAGGGAACAGGCTCTATTTCTGG + Intergenic
1002432587 5:179212133-179212155 GAGGTTGCAGACTCAGTCCCAGG - Intronic
1006401378 6:33819640-33819662 GAGGATTCTGACTCGGTTTCTGG + Intergenic
1007329249 6:41091524-41091546 AAAGTTACAGTCCCTGTTTCAGG + Exonic
1010749541 6:79602632-79602654 GAGGTAGCAGAATCTGTTCCAGG + Intergenic
1014016041 6:116531216-116531238 CAGGTTAAAGACTCTCTTTTTGG + Intronic
1015013879 6:128386377-128386399 TAGGTAACAGACCCTGTTACTGG - Intronic
1020980124 7:15056697-15056719 GATGTTACAAACTCTGTGTTTGG - Intergenic
1025294657 7:57766966-57766988 GAGGTTGAAAACACTGTTTCTGG - Intergenic
1033491570 7:141848593-141848615 CAGGCTACAGACTCTTTTCCTGG - Intergenic
1034378814 7:150670973-150670995 AAGGTAACAGACTCTTTTCCTGG + Intergenic
1034951825 7:155303320-155303342 GAGGCTGCAGAGTCTGTCTCGGG + Intronic
1035820433 8:2585865-2585887 GAAGTTAGAGACTCTTTTACTGG + Intergenic
1040135225 8:43845534-43845556 GAGGTTACAAACACTCTTTCTGG + Intergenic
1040916497 8:52570495-52570517 GAGTTTACAAACTCTGGGTCAGG + Intergenic
1040995552 8:53397588-53397610 GTGGTTACAGTTTCTGTTTAGGG + Intergenic
1041542116 8:58997042-58997064 GAGGTTAGTGAGTCTGGTTCTGG - Intronic
1045551482 8:103176715-103176737 AAGGGTTCAGACTCTGCTTCTGG + Intronic
1047618032 8:126579378-126579400 AACGTTACAGACTGTATTTCTGG + Intergenic
1047859220 8:128946356-128946378 GAGGATAGAGAATCTGTATCTGG + Intergenic
1049633581 8:143673233-143673255 GAGGTTACAGTGGCTGTTGCTGG + Intergenic
1054161769 9:61677327-61677349 GAGGTTGAAAACACTGTTTCTGG + Intergenic
1057952591 9:99381703-99381725 GAAATGACAGTCTCTGTTTCAGG + Intergenic
1058486064 9:105444567-105444589 GAGGATACAGAACCTGGTTCTGG + Intergenic
1059382387 9:113936266-113936288 GAGGTAACAGGCTCAGATTCTGG - Intronic
1059590146 9:115650255-115650277 GAGTTTTCAGACACTGTTTCTGG - Intergenic
1061028591 9:128066579-128066601 GAGGTCACTCACTCTGTGTCAGG + Exonic
1185551328 X:984506-984528 GTGGTTGCAGTCTCTTTTTCTGG - Intergenic
1186875719 X:13815944-13815966 GCGGTTACAGAATATGTTTTTGG + Intronic
1187092853 X:16115648-16115670 GAGTTTGCTGATTCTGTTTCAGG - Intergenic
1187355509 X:18566751-18566773 GAGGTGAGAGAAACTGTTTCTGG + Intronic
1188557432 X:31428395-31428417 GTGGTGACAGCCTCTGCTTCTGG - Intronic
1189767150 X:44383422-44383444 GAGGTTACACTTTCTTTTTCAGG - Intergenic
1192032058 X:67524427-67524449 GATGTTACAGTCTCTTTTTTTGG - Intergenic
1192640097 X:72853621-72853643 GAGCTTCCAGACTCTATCTCAGG - Intergenic
1192641614 X:72867184-72867206 GAGCTTCCAGACTCTATCTCAGG + Intergenic
1196604767 X:117644602-117644624 GAGCCTAGAGACTCTGTCTCTGG - Intergenic