ID: 1185291164

View in Genome Browser
Species Human (GRCh38)
Location 22:50028522-50028544
Sequence CCTGAATCGCAGTGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185291151_1185291164 20 Left 1185291151 22:50028479-50028501 CCTCCCGTGGGGCAAGAGGCATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1185291156_1185291164 -4 Left 1185291156 22:50028503-50028525 CCGTGAGTGGGTCCCAGCCCCTG 0: 1
1: 0
2: 2
3: 34
4: 332
Right 1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1185291153_1185291164 16 Left 1185291153 22:50028483-50028505 CCGTGGGGCAAGAGGCATCTCCG No data
Right 1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1185291152_1185291164 17 Left 1185291152 22:50028482-50028504 CCCGTGGGGCAAGAGGCATCTCC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185291164 Original CRISPR CCTGAATCGCAGTGGGAATC AGG Intronic
904489148 1:30847590-30847612 CCTGTTTCCCAGAGGGAATCCGG + Intergenic
909052293 1:70780861-70780883 CTTGACTCAGAGTGGGAATCAGG + Intergenic
915898853 1:159832051-159832073 CCTGAGTCTCAGTGGAAATGAGG - Intronic
1065352081 10:24804682-24804704 CCTGTCTTGCTGTGGGAATCTGG - Intergenic
1070151412 10:73807587-73807609 CCTGTACCACAGTGGGAAGCCGG + Exonic
1073060245 10:100729609-100729631 TCTGAGTCGCAGTGGGAAGGCGG + Intergenic
1082003486 11:47407615-47407637 CCTGAACAGCAGTGGGAGTCTGG - Intronic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1090919425 11:131195025-131195047 CCCTGATCACAGTGGGAATCCGG - Intergenic
1096365370 12:51024865-51024887 CCGGAATGGCAGTGGGACTCGGG - Intronic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1106840170 13:33678342-33678364 GCTGATTCGCAGTTGGAATGGGG + Intergenic
1108819727 13:54334115-54334137 TCTGAATCACACTGGGAATGGGG - Intergenic
1110325625 13:74211388-74211410 CCTGAATGGCTGTGTGAATTAGG + Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1125205481 15:37149582-37149604 CTTCCATCCCAGTGGGAATCTGG - Intergenic
1131544939 15:93308163-93308185 CCTGAGTGGCGGTGGGACTCCGG - Intergenic
1132560670 16:592106-592128 CCTGAAGCGCAGATGGACTCTGG - Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1140556905 16:75931631-75931653 CCTAAATCACATTGGAAATCAGG + Intergenic
1141297182 16:82781025-82781047 CCTGAAAGGCAGTGGGATTTAGG + Intronic
1141454615 16:84132074-84132096 CCTGAATTTTAGTGGGAATTTGG - Intronic
1142596550 17:1032379-1032401 TGGGAATCCCAGTGGGAATCGGG + Intronic
1143336140 17:6172959-6172981 CCTGAATTGCAGTGAGATTCAGG + Intergenic
1144839551 17:18177417-18177439 CCTGAGGCTCAGTGAGAATCAGG - Intronic
1146293821 17:31632732-31632754 CCTTAATCGCTGAGGGATTCAGG - Intergenic
1151962194 17:77411722-77411744 TCTCAATCACAGTGGGAAGCTGG - Intronic
1153409021 18:4772739-4772761 CCTGAATTGCACTGGGAAGGAGG - Intergenic
1153590234 18:6666079-6666101 CCTGATTCCCAATGGTAATCTGG + Intergenic
1153643556 18:7175262-7175284 CCAGAATCCCAATGGGAAGCAGG + Intergenic
1153818432 18:8810889-8810911 CCTGAATCTTAGTGGAACTCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159367164 18:67483407-67483429 CCTGAAGCTCAGTGGGCAACAGG + Intergenic
1160172996 18:76569903-76569925 CCTGAAATGCAGTGTGAGTCTGG + Intergenic
1166333424 19:42091535-42091557 CCTTGATGGCAGCGGGAATCTGG - Exonic
925898081 2:8488531-8488553 CCTGAAGCCCAGTAGGCATCGGG - Intergenic
927577200 2:24209598-24209620 CCAGAATCTCAGCTGGAATCTGG + Intronic
932274590 2:70442667-70442689 CCTGAAGCCCAGTGGGAGTGGGG + Intergenic
933610347 2:84427989-84428011 GCTGCATCTTAGTGGGAATCAGG - Intronic
941068833 2:160933179-160933201 CCTGAGTCACTGTGGGAATTGGG + Intergenic
942147096 2:173037681-173037703 CATGAATTGCAGTGTGAATGTGG + Intronic
942819042 2:180089389-180089411 CCTGAACCCCAGTGAAAATCAGG - Intergenic
947046771 2:225996001-225996023 CATGATTCATAGTGGGAATCTGG + Intergenic
947939847 2:234042819-234042841 GCTGAATAGAAGTGGGAATGTGG - Intergenic
1181455146 22:23055061-23055083 CCTGAACCTCAGTGGGACTGAGG + Intergenic
1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG + Intronic
960912250 3:122661300-122661322 CCGGTATCGCGGTGGGTATCGGG + Intergenic
963316042 3:143759825-143759847 CCTAAATCTCAGTGGGATTTAGG - Intronic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
975307141 4:72863212-72863234 GCAGTATTGCAGTGGGAATCTGG + Intergenic
975418727 4:74137945-74137967 CAAGAATGGCAGTGGGAATGAGG + Intronic
980092515 4:128457174-128457196 CTTGAATCCCAGGGGAAATCTGG - Intergenic
1000711264 5:164581918-164581940 CCTGAATTGGTGTGGGCATCTGG + Intergenic
1002924027 6:1594651-1594673 CCTGAATCCCGGTGGGAAAAAGG - Intergenic
1004311485 6:14549766-14549788 CCTGGATCCCAGGGGGAATTAGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1010898010 6:81390144-81390166 CCTCAATTGTAGTGGGAATGAGG - Intergenic
1015427804 6:133092533-133092555 CTGGAATAGCAGTGGGGATCTGG + Intergenic
1019421522 7:953383-953405 CCTCCATCCCAGAGGGAATCAGG + Intronic
1025251801 7:57356438-57356460 CCTGAATCTCAGGGGGCAACAGG - Intergenic
1037981846 8:23259891-23259913 CTTCAAGGGCAGTGGGAATCAGG + Intronic
1049161613 8:141101750-141101772 CCTGACTCACAGTGGGCTTCTGG + Intergenic
1053042981 9:34890479-34890501 CCAGAATCCCAGTGGGCATGGGG + Intergenic
1053382026 9:37656720-37656742 CCTGAAGGACAGTGGGAAGCCGG + Intronic
1189284929 X:39845254-39845276 CTTGAGTGGCAGTGGGAGTCAGG + Intergenic
1190158193 X:48010518-48010540 CAGGAAGCTCAGTGGGAATCAGG + Intronic
1190173964 X:48133400-48133422 CAGGAAGCTCAGTGGGAATCAGG + Intergenic
1191603246 X:63033204-63033226 CTAGAATCTCAGTGGGAATATGG + Intergenic
1200276605 X:154738831-154738853 CCAGAATCTAAGTGGCAATCTGG + Intronic
1201489106 Y:14522853-14522875 CCTGAAACGCAGTATGATTCAGG - Intronic