ID: 1185292497

View in Genome Browser
Species Human (GRCh38)
Location 22:50034241-50034263
Sequence GGCCCACAGCACCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 427}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185292497_1185292508 28 Left 1185292497 22:50034241-50034263 CCTTCCCTGTGGTGCTGTGGGCC 0: 1
1: 0
2: 6
3: 125
4: 427
Right 1185292508 22:50034292-50034314 GCATCAAGTGTGGCCGTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 57
1185292497_1185292505 18 Left 1185292497 22:50034241-50034263 CCTTCCCTGTGGTGCTGTGGGCC 0: 1
1: 0
2: 6
3: 125
4: 427
Right 1185292505 22:50034282-50034304 ACGGCTCCTGGCATCAAGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1185292497_1185292502 6 Left 1185292497 22:50034241-50034263 CCTTCCCTGTGGTGCTGTGGGCC 0: 1
1: 0
2: 6
3: 125
4: 427
Right 1185292502 22:50034270-50034292 TGTCCCTCACTCACGGCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 142
1185292497_1185292501 -1 Left 1185292497 22:50034241-50034263 CCTTCCCTGTGGTGCTGTGGGCC 0: 1
1: 0
2: 6
3: 125
4: 427
Right 1185292501 22:50034263-50034285 CTGAAACTGTCCCTCACTCACGG 0: 1
1: 0
2: 1
3: 10
4: 168
1185292497_1185292507 25 Left 1185292497 22:50034241-50034263 CCTTCCCTGTGGTGCTGTGGGCC 0: 1
1: 0
2: 6
3: 125
4: 427
Right 1185292507 22:50034289-50034311 CTGGCATCAAGTGTGGCCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185292497 Original CRISPR GGCCCACAGCACCACAGGGA AGG (reversed) Intronic
900316483 1:2059774-2059796 GGCTGACAGCACCACATGGCGGG + Intronic
900526126 1:3129669-3129691 GGCCCTCAGTGCCACAGGTAGGG + Intronic
900975638 1:6014597-6014619 GGCAAGCAGCACCACAGAGAGGG + Intronic
901834152 1:11912880-11912902 GAAGCACAGCACCACAGGGAGGG + Intergenic
901924425 1:12556887-12556909 GGCCCGCAGCAGAACCGGGAGGG - Intergenic
902303722 1:15521397-15521419 GAAGCACAGCACCACAGGGAGGG - Intronic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
903231236 1:21923507-21923529 GGCCCACAGCAGCAGAGAGAAGG - Intronic
903231947 1:21927446-21927468 GGCCCAGAGCTCCCCAGGCAAGG + Intronic
903661613 1:24981962-24981984 GGCAGACAGCACCATCGGGAGGG - Intergenic
904740034 1:32667171-32667193 GAAGCACAGCACCACAAGGAGGG - Intronic
904746356 1:32713588-32713610 CGACCATAGGACCACAGGGAGGG - Intergenic
904824164 1:33263983-33264005 AGGCCACAGCAGCAAAGGGAAGG - Intronic
905871535 1:41407143-41407165 GGCCCACTGAACCTCAGGGCTGG - Intergenic
906086458 1:43139259-43139281 GAAGCACAGCACCACAGGCAGGG - Intergenic
907288842 1:53399684-53399706 GAAGCACAGCACCACAGGGAGGG - Intergenic
907475465 1:54702276-54702298 CGCCCACAGGACCCGAGGGAGGG - Intronic
907549547 1:55292657-55292679 GGCCCACAGCATGCCAGGCATGG - Intergenic
909037370 1:70609302-70609324 AGCCCACAAAACCAAAGGGAGGG - Intergenic
909413366 1:75378894-75378916 TGCCCCCAGCACCACAGGGCAGG + Intronic
911848557 1:102784860-102784882 GGCTCACAGTTCCACAGGGCTGG + Intergenic
911968996 1:104406806-104406828 CCCCCCCATCACCACAGGGAGGG - Intergenic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
912579270 1:110705554-110705576 GACCCACAGTTCCACAGGGGTGG + Intergenic
913174604 1:116262488-116262510 GGACCACAGCACTGCAGAGAGGG + Intergenic
914509307 1:148317494-148317516 GGCCCTCAGGACAAAAGGGATGG - Intergenic
915075592 1:153306134-153306156 GGCCCCCAGCACCCCTGGGATGG - Intronic
915233174 1:154461256-154461278 GAAGCACAGCACCACAGGGAGGG + Intronic
915402522 1:155634015-155634037 TGCCCCCAGCACCACAGGGCAGG - Intergenic
915622742 1:157095805-157095827 GGCCCCCAGCAGCTCAGGGGTGG + Intronic
915624041 1:157103716-157103738 AGCCCACAGCACAAGAGGGGAGG - Intergenic
916009574 1:160692585-160692607 TGCCCCCAGCACCACAGGGCAGG + Intronic
916290312 1:163158710-163158732 GGACCACAGGACCACAGGACCGG + Intronic
916525666 1:165606766-165606788 GAAGCACAGCACCACAGGGAGGG + Intergenic
916993103 1:170266170-170266192 GACCCACAGTTCCACAGGGCTGG + Intergenic
917144121 1:171869310-171869332 AGCCCACAGCTCCTCAGGCATGG - Intronic
920179927 1:204126302-204126324 GGCCAACAGCTCCTCAGGAAGGG - Exonic
921118912 1:212119683-212119705 GGCACACAGAACCAGAGGGCTGG - Intergenic
922045102 1:221938064-221938086 GGCCTACAGGATCACAGGCAGGG - Intergenic
922469337 1:225866294-225866316 CGCCCACAGCTTCACAGGGGAGG - Intronic
922788897 1:228298899-228298921 GGCCCACAGTATCACAGGAGAGG - Intronic
922802564 1:228371063-228371085 GCCCCGCAGCAGCTCAGGGATGG - Exonic
923295218 1:232587960-232587982 GACCCACAGTACCACATGGCTGG - Intergenic
924452311 1:244189479-244189501 TGACCACAGCACCAAGGGGATGG - Intergenic
1063320468 10:5047149-5047171 GAAGCACAGCACCACAGGGAGGG + Intronic
1063531071 10:6831817-6831839 CGCTCCCAGCACCACAGGGCAGG - Intergenic
1064893638 10:20209035-20209057 GGACCACAGGACCACAGGACGGG + Intronic
1066542107 10:36458597-36458619 GGCTCACAGTTCCACAGGGCTGG + Intergenic
1067737633 10:48870609-48870631 GGCCCACAGACTCACAGGCAGGG - Intronic
1067788535 10:49270775-49270797 GGTGCACAGCAGCACAGGGAAGG + Intergenic
1068429318 10:56911593-56911615 GAAGCACAGCACCACAGGGAGGG + Intergenic
1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG + Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1070170755 10:73931142-73931164 GAAGCACAGCACCACAGGGAGGG + Intergenic
1070303969 10:75227061-75227083 GCACCCCAGCTCCACAGGGATGG + Intronic
1070586904 10:77773274-77773296 GAAGCACAGCACCACAGGGAGGG + Intergenic
1071513696 10:86283117-86283139 GGCACACAGCAGGGCAGGGAGGG - Intronic
1072068585 10:91894436-91894458 GAAGCACAGCACCACAGGGAGGG - Intergenic
1072819007 10:98537826-98537848 GAAGCACAGCACCGCAGGGAGGG - Intronic
1072947917 10:99827096-99827118 TGCCCCCAGCACCACAGGGCAGG - Intronic
1073342877 10:102759031-102759053 GAAGCACAGCACCACAGGGAGGG + Intronic
1074260366 10:111847586-111847608 GACTCACAGCACCACATGGCTGG - Intergenic
1074608146 10:114994759-114994781 GGCCCAAACCAACACAGTGACGG - Intergenic
1076233145 10:128838591-128838613 GGCCCACATCAGCACAGCCAAGG + Intergenic
1076544401 10:131235084-131235106 GGCCCAGGGTACCACAGGCAGGG + Intronic
1076581756 10:131516802-131516824 GGCCCAGAGCAGCCCAGGGTGGG - Intergenic
1076585014 10:131541092-131541114 GGCTCACTGCACCACAGATATGG - Intergenic
1076645967 10:131954538-131954560 AGCCCACAGCGCCACAGAGGCGG - Intronic
1076900472 10:133335303-133335325 GGCCCGCAGCGCCATAGGGTAGG + Intronic
1076998388 11:310505-310527 GGTCCCCAGCACCACAGAGCAGG - Intronic
1077000354 11:319253-319275 GGTCCCCAGCACCACAGAGCAGG + Intergenic
1077194453 11:1272304-1272326 GGCCTGCAGCACCCCAGGGTGGG + Intergenic
1077233689 11:1469831-1469853 GGCCAGCAGCACCCGAGGGAGGG + Intronic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1077294750 11:1820944-1820966 GGCCCCCAGGGCCACATGGAGGG - Intergenic
1077480184 11:2810947-2810969 GGCCCACAGCACCAAGACGATGG - Intronic
1078827966 11:14950043-14950065 GGCCCACAGCTCAACTGTGAAGG - Intronic
1080070903 11:28085367-28085389 GAAGCACAGCACCACAGGGAGGG - Intronic
1080243526 11:30154385-30154407 GGCCCACAGTTCCACATGGCTGG + Intergenic
1080282279 11:30570879-30570901 AGCCCACAGCAAGACAGGAAAGG + Intronic
1080418880 11:32092822-32092844 GGCCCCCAGGAGCACAGGGATGG - Intronic
1081635323 11:44717685-44717707 GGCCCACAGAGCCCCAGAGATGG - Intergenic
1083875551 11:65522279-65522301 GAAGCACAGCACCACAGGGAGGG + Intergenic
1084164678 11:67370048-67370070 GGCCCACAGAACCAGAAAGAGGG + Intronic
1084444692 11:69196824-69196846 GGCGCAGAGCAGCAGAGGGACGG + Intergenic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1084840616 11:71843434-71843456 AGCCCACAGCTCAACAGGGTTGG - Intergenic
1086410757 11:86541680-86541702 GGGACAGAGCACCTCAGGGAAGG + Intronic
1087723907 11:101696871-101696893 TGCCCCCAGCACCACAGGGCAGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089471931 11:118728344-118728366 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1090845638 11:130527788-130527810 GGACCACAGGCCCCCAGGGAAGG - Intergenic
1094639346 12:32258874-32258896 GAAGCACAGCACCACAGGGAGGG + Intronic
1096183860 12:49565900-49565922 TGCCCTCAGTCCCACAGGGAAGG + Intronic
1097243033 12:57589334-57589356 GAAGCACAGCACCAAAGGGAGGG + Intergenic
1097271866 12:57780438-57780460 GGTCCCCAGCAGCAGAGGGAAGG - Exonic
1097278460 12:57829257-57829279 GGCCCACACCGCAAAAGGGAAGG + Intronic
1097331274 12:58335085-58335107 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1098317390 12:69207105-69207127 GGCCCACAGTTCCACATGGCTGG + Intergenic
1098625435 12:72660300-72660322 GAAGCACAGCACCACAGGGAGGG + Intronic
1099905249 12:88762979-88763001 GGCTCACAGCTCCACATGGCTGG + Intergenic
1100607233 12:96161875-96161897 GACCCAGAGGACCACAGGAATGG - Intergenic
1100993347 12:100274654-100274676 GGCCTACAGTAACACTGGGATGG + Intronic
1101182573 12:102235392-102235414 GCCCCACTCCACCACAGTGATGG + Intergenic
1101658971 12:106749285-106749307 GGCCCACTGCACCACATGGTAGG - Intronic
1101875069 12:108592182-108592204 GGCCCTCAGCCCCACATCGATGG - Exonic
1103466935 12:121149398-121149420 GGCCCACAGTTCCACATGGCTGG + Intronic
1103508346 12:121456215-121456237 GGCCCACAGACCCACTGGGATGG + Intronic
1103978760 12:124722055-124722077 GCCCTACAGCCCCACAGCGAGGG + Intergenic
1104012723 12:124943392-124943414 GGCTCAGAGCACCACAGGAGAGG + Intergenic
1104841521 12:131828234-131828256 GGTCCGCGGCATCACAGGGAAGG - Intergenic
1105730644 13:23211979-23212001 GGACAACAGCACCAAGGGGATGG - Intronic
1105855593 13:24369140-24369162 GAAGCACAGCACCACAGAGAGGG + Intergenic
1105927088 13:25018310-25018332 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
1106335037 13:28776490-28776512 GGGACAGAGCACCTCAGGGAAGG - Intergenic
1106715898 13:32387628-32387650 GAAGCACAGCACCACAGGGAGGG - Intronic
1108090421 13:46843641-46843663 AGCCCAGAGCACCATGGGGAAGG + Intronic
1108219104 13:48215361-48215383 GACTCACAGTTCCACAGGGATGG - Intergenic
1111108484 13:83675883-83675905 GAAGCACAGCACCGCAGGGAGGG + Intergenic
1112014128 13:95317323-95317345 GAAGCACAGCAACACAGGGAGGG - Intergenic
1112430950 13:99349800-99349822 GAAGCACAGCATCACAGGGAGGG + Intronic
1112433458 13:99373542-99373564 GGCTCACAGCTCCTCAGGGCAGG - Intronic
1112533130 13:100224125-100224147 GCCCCACAGGAGCCCAGGGAGGG + Intronic
1112554782 13:100456822-100456844 GAAGCACAGCATCACAGGGAGGG + Intronic
1113671561 13:112178968-112178990 GCCCCACAGCCTCACAGGGAGGG - Intergenic
1113745499 13:112741608-112741630 GTCCCAGATCAGCACAGGGACGG - Intronic
1113917129 13:113881144-113881166 GGCCCTGAGCAGCACAGGGCAGG + Intergenic
1116561456 14:46384716-46384738 GAAGCACAGCTCCACAGGGAGGG + Intergenic
1117629324 14:57673367-57673389 GGCACACAGCTCCACAGTGCTGG - Intronic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1119028363 14:71171716-71171738 TCCCCAGAGCACCTCAGGGAAGG - Intergenic
1119613626 14:76083963-76083985 GGCCCAGAGCACCCACGGGAAGG - Intronic
1119691625 14:76677411-76677433 GGCAGACAGCACCAGAGGAATGG - Intergenic
1119983737 14:79112226-79112248 GGCCTACAGCTCCAGAGAGAAGG - Intronic
1120909092 14:89649286-89649308 GGCACACAACCCCACAGGGACGG + Intergenic
1121016626 14:90552981-90553003 GGCCCAAAGAACCTCAGGAAGGG + Intronic
1121564211 14:94896523-94896545 AGCCCACAGAAGAACAGGGAGGG + Intergenic
1121714210 14:96061176-96061198 TCCTCACAGCACCTCAGGGAGGG + Intronic
1122236056 14:100331167-100331189 TGCCCACAGCACCACACATATGG - Intergenic
1122352870 14:101106903-101106925 GGCTCATAGTTCCACAGGGATGG + Intergenic
1122577419 14:102751017-102751039 GGCCCACACCAGCCCAGGGGTGG - Intergenic
1122596788 14:102899327-102899349 GGCCTGCAGCAGCAGAGGGATGG - Intronic
1122671046 14:103372687-103372709 GGCCAGCAGCCCCACGGGGAAGG + Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1123940935 15:25216350-25216372 GGCCCACTGCTCAACAGGGTTGG - Intergenic
1123946341 15:25240661-25240683 GGCCCATTGCTCAACAGGGATGG - Intergenic
1124784288 15:32664911-32664933 GGCCCAGACCACAGCAGGGAGGG - Intronic
1125116622 15:36101088-36101110 GGCTCACAGTTCCACAGGGCTGG + Intergenic
1125751489 15:42032377-42032399 TGCCCACCACCCCACAGGGAAGG + Intronic
1125785796 15:42316634-42316656 GAAGCACAGCACTACAGGGAGGG + Intronic
1127345809 15:58096821-58096843 GGCCCACAGTACTGCAGGGCTGG + Intronic
1127395976 15:58544240-58544262 GACCCACAGCACCAGTTGGATGG - Intronic
1127417078 15:58768682-58768704 GAAGCACAGCACCACAGGGAGGG - Intergenic
1127983425 15:64050584-64050606 TGGACTCAGCACCACAGGGATGG + Intronic
1128513202 15:68326334-68326356 GGGGCACAGCCCCAAAGGGAGGG - Intronic
1128566067 15:68700980-68701002 CGCCCCCAGCTCCTCAGGGAGGG - Intronic
1129219393 15:74122761-74122783 AGCCCAGAACAGCACAGGGAGGG - Intronic
1129468083 15:75735104-75735126 GAAGCACAGCACCACAGGGAGGG - Intergenic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1129865278 15:78902734-78902756 GAAGCACAGCACCACAGGGAGGG + Intergenic
1130011479 15:80155983-80156005 GAAGCACAGCACCACAGGGAGGG + Intronic
1132639706 16:972178-972200 CGGCCCCAGCAACACAGGGAAGG - Intronic
1132751662 16:1460472-1460494 GGCCCACAGCAACAGGGAGAAGG + Exonic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1133810003 16:9154512-9154534 GGCGCACAGAACCAGAGGGCGGG + Intergenic
1133934689 16:10259152-10259174 GAAGCACAGCACCACAGGGAGGG - Intergenic
1134061410 16:11201874-11201896 GCCTCCCAGCACCACAGAGAGGG + Intergenic
1134236585 16:12471030-12471052 GGCGCACAGCTACATAGGGAGGG - Intronic
1136710373 16:32232077-32232099 GAAGCACAGCACCACAGGGAGGG + Intergenic
1136711787 16:32243429-32243451 GAAGCACAGCACCACAAGGAGGG - Intergenic
1136756129 16:32685978-32686000 GAAGCACAGCACCACAAGGAGGG + Intergenic
1136757539 16:32697334-32697356 GAAGCACAGCACCACAGGGAGGG - Intergenic
1136810567 16:33173041-33173063 GAAGCACAGCACCACAGGGAGGG + Intergenic
1136811984 16:33184395-33184417 GAAACACAGCACCACAAGGAGGG - Intergenic
1136817043 16:33283121-33283143 GAAGCACAGCACCACAGGGAGGG + Intronic
1136818460 16:33294475-33294497 GAAACACAGCACCACAAGGAGGG - Intronic
1136825024 16:33351008-33351030 GAAACACAGCACCACAAGGAGGG - Intergenic
1136830090 16:33449779-33449801 GAAACACAGCACCACAAGGAGGG - Intergenic
1137806333 16:51309495-51309517 GACCCACAGTGCCACAGGGCTGG - Intergenic
1140761335 16:78111674-78111696 GAAACACAGCACCACAGGGAGGG - Intronic
1140953162 16:79838408-79838430 AGCCCAGAGCAACACAGGGCAGG + Intergenic
1141541527 16:84726570-84726592 AGCCCACACCACAGCAGGGATGG - Intronic
1142286134 16:89172241-89172263 GGCCCCCAGCCCCCCAGAGAGGG - Intronic
1142366313 16:89651776-89651798 GGCCCAGCACACCGCAGGGAAGG + Intronic
1202990562 16_KI270728v1_random:7365-7387 GAAACACAGCACCACAAGGAGGG - Intergenic
1203058267 16_KI270728v1_random:946330-946352 GAAGCACAGCACCACAAGGAGGG + Intergenic
1203059687 16_KI270728v1_random:957683-957705 GAAGCACAGCACCACAGGGAGGG - Intergenic
1143368750 17:6425428-6425450 GGCCCACAGCCACCCAGGCAGGG - Exonic
1143452963 17:7047217-7047239 GAAGCACAGCCCCACAGGGAGGG + Intergenic
1143459412 17:7091782-7091804 GAAGCACAGCCCCACAGGGAGGG + Intergenic
1143499974 17:7333028-7333050 GAAGCACAGCACCACAGGGAGGG + Intergenic
1145250933 17:21296671-21296693 CTCCCACAGCCCTACAGGGAGGG - Intronic
1146143493 17:30389093-30389115 GGCCCAGAGCAGCACAGCGGGGG - Intronic
1146371391 17:32266983-32267005 GGCCCGCAGGACCGGAGGGATGG - Intronic
1146466542 17:33090830-33090852 GGCAGACAGGACCCCAGGGAAGG + Intronic
1146938302 17:36826132-36826154 GGCCCAGGGCACCCCACGGAGGG - Intergenic
1147836389 17:43335142-43335164 GAAGCACAGCACCACGGGGAGGG + Intergenic
1147841178 17:43372648-43372670 GAAGCACAGCACCACAGGGAGGG + Intergenic
1147875131 17:43615610-43615632 GGCCCACATCTGGACAGGGAAGG + Intergenic
1148085030 17:44988648-44988670 GCCCCACAGAACCCCTGGGAAGG + Intergenic
1148934579 17:51154663-51154685 GGACCACAGCACCAGAATGAAGG - Intronic
1149760142 17:59221242-59221264 GGCCCCCAGCACCGCAGACAAGG - Intronic
1150164517 17:62928595-62928617 GGATCACAGCACCACATGGGAGG - Intergenic
1150575901 17:66430584-66430606 GGCTCAGTGCACCACAGGGCTGG - Intronic
1150777762 17:68095372-68095394 GGGCCACAGCACAACAGGGCTGG + Intergenic
1151361829 17:73593565-73593587 GGGCCAGAGCCCCCCAGGGAAGG + Intronic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1151902292 17:77024365-77024387 GGCCATCAGCACCAGAGGCAAGG + Intergenic
1154303453 18:13214364-13214386 GGTCCACAGGATCCCAGGGAGGG + Intergenic
1154379604 18:13837428-13837450 GGCCTGCAGCACCGCAGAGACGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1157587508 18:48814129-48814151 GTCCCACAGCAACACTGAGAAGG - Intronic
1157702096 18:49767875-49767897 GGTGCTCAGCACCTCAGGGAGGG + Intergenic
1160586162 18:79914747-79914769 GGCCCACAGGCCCAAAGAGACGG + Intronic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161284827 19:3463668-3463690 GGCTCACACCCCCAAAGGGAGGG + Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1161870949 19:6869449-6869471 GAAGCACAGCACCACAGGGAGGG - Intergenic
1162292550 19:9791094-9791116 GAAGCACAGCACCACAGGGAGGG + Intronic
1163232567 19:16014496-16014518 GGAGCACAGCACCACAAGGAGGG + Intergenic
1163235925 19:16030563-16030585 GGAACACAGCACCACAGGGAGGG + Intergenic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163815439 19:19462204-19462226 TGCCCCCAGCACAACAGGGCTGG - Intronic
1164153861 19:22576738-22576760 CGCTCCCAGCACCACAGGGCAGG + Intergenic
1164371172 19:27645591-27645613 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1164549596 19:29198128-29198150 GGACCACAGGACCACAGGACTGG + Intergenic
1164679370 19:30123584-30123606 TCCCCACTGCACAACAGGGAAGG + Intergenic
1164724137 19:30453862-30453884 GGCTCACAGCAACAAAGAGATGG - Intronic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
1166140346 19:40802085-40802107 GGACGACAGGAGCACAGGGAAGG - Intronic
1166406278 19:42524330-42524352 AGCCCACAGCAGAACAGGGATGG + Intronic
1166514639 19:43437276-43437298 GAAGCACAGCACTACAGGGAGGG - Intergenic
1167895537 19:52577825-52577847 GAAGCACAGCACCACAGGGAGGG - Intronic
1167927741 19:52835191-52835213 GAAGCACAGCACCACAGGGAGGG + Intronic
1167939122 19:52932114-52932136 GAAGCACAGCACCACAGGGAGGG - Intronic
1167971815 19:53192663-53192685 GGCCCACACATTCACAGGGAGGG + Intronic
1168058585 19:53877767-53877789 GAAGCACAGCACCACAGGGAGGG + Intergenic
1168084739 19:54037246-54037268 GAAGCACAGCACCACAGGGAGGG - Intergenic
1168251663 19:55145661-55145683 GGCCCCCAGGACCCCAGGGAAGG + Intronic
1168726390 19:58584695-58584717 GAAGCACAGCACCACAGGGAGGG - Intergenic
925144587 2:1572302-1572324 CGCACACAACATCACAGGGATGG + Intergenic
925386416 2:3464889-3464911 GGGCCAGACCACCACAGGCAGGG + Intronic
927517907 2:23682703-23682725 GGCTCAGAGCACCAGTGGGAGGG - Intronic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
927713216 2:25338509-25338531 GGCGCACAGCAGCAGGGGGAAGG + Intronic
927718782 2:25369799-25369821 GGCCCAGGGCCACACAGGGAAGG - Intergenic
928050980 2:27995147-27995169 GGCCCACAGCACCCCAGTGAAGG - Intronic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
929164291 2:38865459-38865481 GACTCACAGTACCACAGGGCTGG - Intronic
929337808 2:40771926-40771948 GGCTCACAGTTCCACAGGGCTGG - Intergenic
929489874 2:42386564-42386586 GGCCCACAGCAAGAATGGGAGGG - Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
931116670 2:59173288-59173310 GAAGCACAGCACCACAGGGAGGG - Intergenic
933611839 2:84444527-84444549 GGACCACAGGACCACAGGACCGG + Intronic
933837982 2:86261166-86261188 GGCCCCTAGCACCACACAGAAGG + Intronic
934113810 2:88765572-88765594 GGCCCTCTGCAGCCCAGGGATGG - Intergenic
934636216 2:95992099-95992121 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
934797434 2:97113327-97113349 GGCCCTCTGCAGCCCAGGGATGG - Intergenic
934835978 2:97590112-97590134 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
935194467 2:100804274-100804296 GACCCACAGTTCCACATGGATGG + Intergenic
935245993 2:101219259-101219281 GGCCCAGAGAAACAAAGGGAGGG - Intronic
935518867 2:104078815-104078837 GGCCTCCAGCACCACAGAGCAGG - Intergenic
936444136 2:112583108-112583130 TGCCCACAGGTGCACAGGGAGGG - Intergenic
936644301 2:114350812-114350834 GCCCCAAAGAACCCCAGGGAAGG - Intergenic
937454101 2:122026371-122026393 GACGCAGAGCACCAGAGGGAAGG + Intergenic
937859973 2:126700096-126700118 GGCCTCCAGCTCCACAGGCAGGG - Intergenic
938194376 2:129314144-129314166 TGCCCCCAAGACCACAGGGATGG + Intergenic
939760126 2:146165471-146165493 GGCTCACAGTTCCACAGGGCTGG + Intergenic
940694397 2:156959988-156960010 GGCCCCCAAGAGCACAGGGATGG + Intergenic
941718609 2:168789323-168789345 GGCTCACAGTTCCACATGGATGG + Intronic
943112301 2:183621562-183621584 GGGACAGAGCACCTCAGGGAAGG - Intergenic
944145533 2:196503582-196503604 GGCCAATAGCAGCAAAGGGAAGG + Intronic
945979400 2:216296901-216296923 GGCTCAGAGCACCAAAGGGTGGG + Intronic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
946403934 2:219483138-219483160 GGCCCGCAGCAGCTCGGGGATGG - Exonic
946900569 2:224367997-224368019 GCCCCACAGAGCGACAGGGAAGG - Intergenic
947428979 2:230009187-230009209 GGGGCACAGCACAACAGGGCTGG + Intronic
947965569 2:234278605-234278627 GGAGAACAGCACCAAAGGGATGG + Intergenic
947974363 2:234352242-234352264 GAAGCACAGCACCACAGGGAGGG - Intergenic
948002256 2:234577831-234577853 GGCCCACGGCAGCACTGGTAGGG - Intergenic
948055111 2:235005245-235005267 GGCCAACAGCACAGCAGGGCTGG - Intronic
948525875 2:238570495-238570517 GGGACACAGCAGCACAGGGGAGG + Intergenic
948692886 2:239717998-239718020 GCCACACAGCACCACCGGCAAGG + Intergenic
948930184 2:241127015-241127037 GGCCCCCAGCCCCTCTGGGATGG - Exonic
1168882180 20:1216489-1216511 GAAGCACAGCACCACAGGGAGGG - Intergenic
1169399122 20:5264914-5264936 ACCCCAGAGCACCACAGGGCAGG + Intergenic
1170461494 20:16580890-16580912 GCCCCACTGCACTCCAGGGAAGG + Intergenic
1170795521 20:19543588-19543610 TCCCCACAGCAGCAGAGGGAGGG + Intronic
1171136500 20:22699577-22699599 CGCCCACAGCCTCACAGGGCAGG - Intergenic
1171174429 20:23040836-23040858 AGCCCACAGCGGCCCAGGGAAGG + Intergenic
1172164408 20:32890199-32890221 TGGCCTCAGCACCACAGGGAGGG - Intronic
1173545354 20:43893661-43893683 CACCCACAGAACCAGAGGGAGGG - Intergenic
1173865963 20:46312778-46312800 GGCCGACGGGACCGCAGGGAGGG + Intergenic
1174054482 20:47788495-47788517 GGCCCACAGCCCCAGAAGAAGGG - Intergenic
1174185685 20:48704344-48704366 AGCCCAAAGCACTCCAGGGAGGG + Intronic
1175200438 20:57273225-57273247 GGCTCACAGAACCCCTGGGAAGG - Intergenic
1175365008 20:58447104-58447126 GCTCCACAGCACCTCAGAGAGGG + Exonic
1176060350 20:63169778-63169800 GGCCCTGAGCAGAACAGGGAAGG - Intergenic
1176070376 20:63223172-63223194 GGCCCACAGTTCCACAGAGGAGG + Intergenic
1176168709 20:63687621-63687643 CGCCCCCCGCCCCACAGGGAAGG + Exonic
1176231307 20:64034403-64034425 GGTCCCCAGAACCACAGGGAAGG - Intronic
1176650238 21:9539335-9539357 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1177173261 21:17677011-17677033 GAAGCACAGCACCACAGGGAGGG + Intergenic
1177208773 21:18043792-18043814 GACCCACAGTTCCACAGGGCTGG + Intronic
1177248962 21:18567978-18568000 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1177772488 21:25531949-25531971 GAAGCACAGCACCACAGGGAGGG + Intergenic
1178409700 21:32353027-32353049 GGGACACATAACCACAGGGAAGG + Intronic
1178425235 21:32473847-32473869 GGCCCTCAGCCTCACATGGAAGG - Intronic
1178618535 21:34154361-34154383 GGCACACAGCACCCCAAGGAAGG - Intergenic
1178667309 21:34559850-34559872 GGACCACAGAATCACAGGGCAGG - Intronic
1179275972 21:39891942-39891964 GAAGCACAGCACCACAGGGAGGG + Intronic
1179884800 21:44309326-44309348 AGCCCACAGCATAGCAGGGAGGG + Intronic
1179902743 21:44402400-44402422 CACCCACACCTCCACAGGGAGGG - Intronic
1179944647 21:44664854-44664876 GGGCCACAGCTCCAGAGGGCGGG + Intronic
1180127813 21:45804028-45804050 GGCCCACAACACCACAGATGAGG - Intronic
1180837915 22:18940482-18940504 TGCCCCCAGCACCACAGGGCAGG + Intergenic
1180968122 22:19801055-19801077 GGACCACAGCCCTACAGAGAAGG + Intronic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1181178791 22:21053132-21053154 GGCCCAGAGCACAACAGGAAAGG - Intronic
1181275708 22:21686482-21686504 GGCCCACTATTCCACAGGGAAGG + Exonic
1181575463 22:23791703-23791725 GGGTCGCAGCACCACAGGGAAGG - Intronic
1182084497 22:27551943-27551965 TGAGAACAGCACCACAGGGATGG - Intergenic
1183627410 22:39013195-39013217 GAAGCACAGCATCACAGGGAGGG + Intergenic
1184133439 22:42531630-42531652 GAAGGACAGCACCACAGGGAGGG - Intergenic
1184522523 22:45003554-45003576 GGCCTGCAGAGCCACAGGGATGG - Intronic
1184546168 22:45169892-45169914 GAAGCACAGCACCACAGGGAGGG - Intronic
1184602237 22:45550460-45550482 ACCCCACAGCAGCACAGTGAAGG - Intronic
1184676643 22:46046579-46046601 TGGACCCAGCACCACAGGGAGGG + Intergenic
1184798602 22:46746733-46746755 GGCTCACAGCACCCCAGGGAAGG + Intergenic
1185067438 22:48639237-48639259 GACCCACAGTGCCACTGGGAAGG - Intronic
1185095163 22:48802465-48802487 GGCCCAGAGCAGCCCAGTGATGG - Intronic
1185114664 22:48925302-48925324 GACGCACAGTCCCACAGGGATGG + Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
1185305556 22:50113525-50113547 GGACCACCTCACCACAGGCAGGG - Intronic
950030910 3:9852772-9852794 TGCTCCCAGCACCACAGGGCAGG - Intronic
950364739 3:12474966-12474988 GGGCGACAGGGCCACAGGGAAGG - Intergenic
950589199 3:13923879-13923901 GGCTCACAGTTCCACAGGGCTGG - Intergenic
952735597 3:36688994-36689016 GGCCCAGAGCAGGACAGAGAAGG - Intergenic
952912488 3:38203022-38203044 GAAGCACAGCACCACGGGGAGGG - Intronic
953435462 3:42874193-42874215 GTGCCACAGGACCAGAGGGAGGG + Exonic
954264318 3:49461132-49461154 GGCCCAGAGCATCCCAGAGATGG + Intergenic
954584291 3:51720385-51720407 TGCCCACAACACCATAAGGATGG - Intergenic
954754050 3:52829493-52829515 ACCCTACAGCACCACAGGGCAGG + Intronic
955378777 3:58419948-58419970 GGCTCACAGGGCCTCAGGGAGGG + Intronic
957048729 3:75395975-75395997 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
959021573 3:101192939-101192961 GGCCCAAAGCACAACTGTGATGG - Intergenic
959070050 3:101693702-101693724 TGCCCCCAGCACTACAGGGCAGG + Intergenic
959804868 3:110539354-110539376 GACTCACAGTTCCACAGGGATGG - Intergenic
960028164 3:113031613-113031635 TGCCCCCAGCACCACAGGGCAGG - Intergenic
960717504 3:120591916-120591938 GCCCCAAAGCACCACATGGGAGG - Intergenic
961155489 3:124676153-124676175 GGCCAACAGAACCAAAGGTAGGG - Intronic
961296899 3:125892102-125892124 TGCCCCCAGCACCACAGGGCAGG + Intergenic
961482415 3:127192738-127192760 GGCCCACAGGGCCAGAGGGGAGG - Intergenic
961764191 3:129195580-129195602 GGCCCAAAGCTCCACAAGGTGGG - Intergenic
962411013 3:135141847-135141869 GGACCACAGGTCCTCAGGGAGGG + Intronic
963326960 3:143873945-143873967 GAAGCACAGCACCACAGGGAGGG + Intergenic
963405150 3:144854041-144854063 GAAGCACAGCATCACAGGGAGGG + Intergenic
963408382 3:144898487-144898509 GGGCCACAGAGTCACAGGGATGG + Intergenic
963671490 3:148257599-148257621 GGCTCACAGTTCCACAGGGCTGG - Intergenic
963696027 3:148566747-148566769 TGCCCCCAGCACCACAGGGCAGG - Intergenic
963975954 3:151480847-151480869 TGCCCCCAGCACCACAGCCAAGG + Intergenic
964687453 3:159412967-159412989 GGCTCACAGCTCCACATGGCTGG + Intronic
965304109 3:167042630-167042652 GACTCACAGTTCCACAGGGATGG - Intergenic
965931277 3:174045245-174045267 GACTCACAGTTCCACAGGGATGG + Intronic
966962640 3:184955211-184955233 GAAGCACAGCACCACAGGGAGGG - Intronic
967026596 3:185569901-185569923 TGCCCCCAGCACCACAGGGCAGG - Intergenic
968172419 3:196521250-196521272 GAAGCACAGCACCACAGTGAGGG - Intergenic
968215432 3:196885785-196885807 GGGCCGGAGCACCACAGGAATGG + Exonic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968568578 4:1327768-1327790 GACCCAGACCACGACAGGGAGGG - Intronic
968574929 4:1361207-1361229 GGACCACAGCACCACAGGCCTGG - Intronic
968689758 4:1984430-1984452 GGCTCACAGCACCTCAGGCCAGG - Intronic
968828113 4:2914583-2914605 AGCACAGAGCACCTCAGGGAGGG - Intronic
968969553 4:3786499-3786521 GGCACACAGCACTGCAGCGATGG - Intergenic
969656013 4:8499002-8499024 GAGCCACAGAACCACAGAGAGGG - Intergenic
969707902 4:8821744-8821766 GCCCCACAGCAACAGAAGGAAGG + Intergenic
969721653 4:8895566-8895588 GGTCCACAGCAGCGCAGGGTGGG + Intergenic
969781710 4:9409427-9409449 AGCCCACAGCTCAACAGGGTTGG - Intergenic
970362125 4:15320713-15320735 GGACCATAGCATCACAGGGTGGG - Intergenic
972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG + Intergenic
973266818 4:48219432-48219454 GAAGCACAGCACCACAGGGAGGG - Intronic
973960916 4:56108919-56108941 GAAGCACAGCACCACAGGGAGGG + Intergenic
974468707 4:62291720-62291742 GGAGGACAGCACCAAAGGGATGG - Intergenic
974672158 4:65046366-65046388 GGCATACAGCACCACAGGGGAGG - Intergenic
975047053 4:69818268-69818290 CCCGCACAGCACCAAAGGGAAGG - Intronic
975419041 4:74140670-74140692 GACCCACAGTTCCACAGGGCCGG + Intronic
976254434 4:83085226-83085248 GAAGCACAGCACCACAGGGAGGG - Intergenic
977911996 4:102548087-102548109 AGCACACAGCACTCCAGGGAAGG + Intronic
978735177 4:112076933-112076955 GCCCCACAGCATCTCAGGGCAGG - Intergenic
979571007 4:122224661-122224683 AGGTCACAGCACCACAGGTATGG + Exonic
980846594 4:138332412-138332434 GGCTCACAGTTCCACATGGATGG + Intergenic
981629747 4:146804768-146804790 GGGACACAGCACCTCGGGGAAGG + Intronic
981776883 4:148378535-148378557 GGAGAACAGCACCAAAGGGATGG - Intronic
981927221 4:150153274-150153296 TGCCTTCAGCACCACATGGAAGG - Intronic
982395108 4:154907758-154907780 GAAGCACAGCACCACAGGGAGGG + Intergenic
982876760 4:160660427-160660449 TGCCCCCAGCACCACAGGGCAGG + Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
985161493 4:187048961-187048983 GACCCAAAGAACCACAGAGAGGG - Intergenic
986294294 5:6424294-6424316 TGTCCACAGCACCACAGCGTGGG + Intergenic
986663927 5:10083499-10083521 CACCCACAGCACCAAATGGAAGG + Intergenic
987397873 5:17442996-17443018 TGCCGTCAGCACCAAAGGGATGG + Intergenic
988180236 5:27781840-27781862 GGCTCTCAGCACCACAGTGATGG + Intergenic
988264056 5:28927864-28927886 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
988380731 5:30494285-30494307 TACCCCCAGCACCACAGGGCAGG - Intergenic
989837163 5:46007375-46007397 TGCTCCCAGCACCACAGGGCAGG - Intergenic
994425203 5:99576552-99576574 GGCCTGCAGGAGCACAGGGATGG + Intergenic
994436136 5:99735681-99735703 GGCCTGCAGGAGCACAGGGATGG - Intergenic
997439524 5:133899439-133899461 GGCCAAGAGCACCACAGCGCAGG - Intergenic
998029432 5:138852263-138852285 AGCCCACAGCCTCACAGGCAAGG - Intronic
998489772 5:142536472-142536494 GCACCCCAGCTCCACAGGGAGGG + Intergenic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999952428 5:156665055-156665077 TGCCCCCAGCACCACAGGGCAGG - Intronic
1001447061 5:171793956-171793978 GGCCCACACCAGCACTGGGGGGG - Intronic
1001559096 5:172657805-172657827 GAAGCACAGCACCACAGGGAGGG - Intronic
1002567146 5:180118608-180118630 GGCCCACAGCAGCCGAGAGAAGG - Exonic
1003073144 6:2960268-2960290 GCCCCACTGCACTACAGGGAAGG + Exonic
1003618221 6:7674156-7674178 AGCCCAGAGCCACACAGGGAAGG - Intergenic
1004058405 6:12164370-12164392 GGCCCACAGCACTACCGCGGAGG + Exonic
1005864968 6:29930403-29930425 GAAGCACAGCACCACAGGGAGGG + Intergenic
1006368717 6:33631614-33631636 GAAGCACAGCACCACAGGGAAGG + Intronic
1006401193 6:33818467-33818489 AGCACACAGCACAGCAGGGAGGG - Intergenic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1006929212 6:37677769-37677791 GGCCCATAGCAGCACAGAAAGGG + Intronic
1006931569 6:37692137-37692159 GGCCCACAGGAGCCCAGGAAAGG + Intronic
1007126920 6:39433258-39433280 GCCCCAGTGCACCTCAGGGAAGG - Intronic
1007551628 6:42734240-42734262 GAAGCACAGCACCACAGGGAGGG + Intergenic
1008060956 6:46996497-46996519 GGCCCACAGTTCCACATGGCTGG - Intergenic
1008517111 6:52328467-52328489 GTCCCACAGCAGAACAGGCAGGG + Intergenic
1010592215 6:77724544-77724566 TGCCCCCAGCACCACAGGGCAGG - Intronic
1011467319 6:87671630-87671652 GGCCAACAGCAAGACAGAGAAGG + Intergenic
1014989218 6:128053279-128053301 GGAGCACAGCCGCACAGGGAAGG - Intronic
1015694530 6:135965515-135965537 GGCCCACAGTTCCACATGGCTGG + Intronic
1016638509 6:146322501-146322523 GGGACAGAGCACCTCAGGGAAGG - Intronic
1017708963 6:157148736-157148758 GGGGCACAGCACCACATGGCTGG - Exonic
1018931517 6:168243095-168243117 GGCCCTGAGCTCCACATGGAGGG - Intergenic
1018940833 6:168308127-168308149 TGCCCACTGGCCCACAGGGAGGG - Exonic
1018993598 6:168693224-168693246 GGCCAACAGCCTCACATGGACGG - Intergenic
1018993749 6:168694807-168694829 GGCCAACAGCCTCACATGGACGG + Intergenic
1018995333 6:168705754-168705776 AGCACACAGCACCCCAGGGCGGG + Intergenic
1018995345 6:168705790-168705812 AGCACACAGCACCCCAGGGCGGG + Intergenic
1019312433 7:369335-369357 GGCTGTCAGCACCACCGGGAGGG - Intergenic
1019424023 7:964720-964742 GGCCCAGAGCCCCCCAGGGTCGG - Intronic
1019437681 7:1030441-1030463 GGCCACTAGCCCCACAGGGATGG + Intronic
1019481857 7:1270578-1270600 TGCCCTCAGCACCCCTGGGAAGG + Intergenic
1019666787 7:2255965-2255987 CGCACACAGCATCACAGGGCTGG + Intronic
1019976889 7:4590067-4590089 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1019977824 7:4598570-4598592 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1020432559 7:8128614-8128636 GGCCCAGGGCACGACAGTGAAGG + Intronic
1023300739 7:38768215-38768237 GGCCAACATCACCAGAGGCATGG + Intronic
1023545290 7:41312077-41312099 GGCCCAAGCCACCCCAGGGAGGG - Intergenic
1023788725 7:43735055-43735077 GAAACACAGCACCACAGGGAGGG + Intergenic
1024174069 7:46820247-46820269 GAAGCACAGCACCACAGGGAGGG + Intergenic
1024250950 7:47505314-47505336 GGTGCACAGCACCCCAGGAAAGG + Intronic
1024373268 7:48610375-48610397 GCCCCACAGAACCACAGGGGCGG - Intronic
1024449901 7:49527770-49527792 GTCCCACAGTTCCACAGGGCTGG + Intergenic
1024456551 7:49614951-49614973 GAAGCACAGCACCACAGGGAGGG - Intergenic
1025213170 7:57032942-57032964 GGCTCACAGCAGCACTGGCAGGG + Intergenic
1025276861 7:57589631-57589653 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1025658783 7:63543882-63543904 GGCTCACAGCAGCACTGGCAGGG - Intergenic
1026870126 7:73845874-73845896 GAAGCACAGCCCCACAGGGAGGG - Intergenic
1028007493 7:85593474-85593496 GGGCCCCAGCACCACAGACAAGG - Intergenic
1028805994 7:95026690-95026712 GGGACAGAGCACCTCAGGGAAGG - Intronic
1028998323 7:97126423-97126445 GGGCCACAGCACCTGGGGGAAGG - Intronic
1029524955 7:101088654-101088676 GGACCCCAGCCCCACAGGGGTGG + Exonic
1029598069 7:101548255-101548277 GGCTCCCTGCACCACAGGGAGGG + Intronic
1029664120 7:101983434-101983456 GGCCCAGGGCACCCCAGGGTGGG - Intronic
1029967173 7:104751960-104751982 TGCCCCCAGCACCACAGGGCAGG - Intronic
1030274864 7:107709626-107709648 GGCCCACAGCAGCAGGAGGATGG + Intronic
1033206080 7:139424201-139424223 GGCACGCAGCCCCACAGTGATGG - Intergenic
1034125162 7:148664699-148664721 AGCCCCCAACAACACAGGGATGG - Intergenic
1034881445 7:154765739-154765761 GCCCCCCAGCAGGACAGGGAAGG + Intronic
1034947856 7:155275324-155275346 GGCCAACTGGACCACAGGAATGG - Intergenic
1034954694 7:155327195-155327217 GGCCTGCAACACCACAGAGAAGG + Intergenic
1034956895 7:155340389-155340411 GAACCACAGGACCCCAGGGATGG + Intergenic
1035056429 7:156039544-156039566 GGTCCACAGCTTCACTGGGAGGG - Intergenic
1035432813 7:158835028-158835050 GAAGCACAGCACCACAGGGAGGG - Intergenic
1035929937 8:3768995-3769017 GGCCCACAGCACACCTGGGGAGG + Intronic
1036133320 8:6136430-6136452 GGCCGAGAGCAACAAAGGGATGG - Intergenic
1036292432 8:7505515-7505537 TGCCCCCAGCACCACAGGGCAGG - Intronic
1036358543 8:8061858-8061880 GACCCACAGCTCCTCATGGAGGG + Intergenic
1037025278 8:14028081-14028103 GAAGCACAGCACCACAGGGAGGG + Intergenic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1037670522 8:21011576-21011598 ACCCCACAGCAAGACAGGGAGGG - Intergenic
1037904411 8:22707072-22707094 GGCCCTTAGCACCTCATGGAGGG - Intergenic
1038577486 8:28717435-28717457 CTCCCCCAGCACCACCGGGACGG - Exonic
1039901765 8:41757844-41757866 GGCCCAGGGCCCCACAGAGAAGG - Intronic
1039924739 8:41919213-41919235 GGTAAACACCACCACAGGGATGG - Intergenic
1040388727 8:46932256-46932278 GGCTGGCAGCACCACAGGAAAGG - Intergenic
1040507060 8:48058424-48058446 GGCGCACACCACCACAGGCCCGG - Intronic
1041460526 8:58106560-58106582 GGCCAACAGGAACCCAGGGAAGG + Intronic
1041595486 8:59646104-59646126 GACTCACAGTTCCACAGGGATGG + Intergenic
1041596922 8:59665883-59665905 GAAGCACAGCACCACAGGGAGGG - Intergenic
1041650203 8:60294721-60294743 GAAGCACAGCACCACAGGGAGGG - Intergenic
1043055578 8:75433362-75433384 GGGCCACAGCACCACAGCCTGGG + Intronic
1043109837 8:76167394-76167416 CTCCCACATCAACACAGGGAGGG + Intergenic
1044361935 8:91295736-91295758 GGGACACAGCGGCACAGGGAAGG + Intronic
1045307283 8:100969108-100969130 GAAGCACAGCATCACAGGGAGGG - Intergenic
1045601340 8:103721066-103721088 GGAGAACAGCACCAAAGGGATGG - Intronic
1046413863 8:113884638-113884660 GAAGCACAGCACCACAGGGAGGG + Intergenic
1047686218 8:127307106-127307128 AGCCAACAGCACAAGAGGGAAGG + Intergenic
1048042751 8:130746966-130746988 GAAGCACAACACCACAGGGAGGG - Intergenic
1048352485 8:133627293-133627315 GGTGCACAGCGGCACAGGGATGG + Intergenic
1048776668 8:137954274-137954296 GGCTCACAGCTCCACAGGGCTGG + Intergenic
1048947397 8:139462131-139462153 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1049171842 8:141166401-141166423 GACACACAGCACCACAGTGGGGG - Intronic
1049396888 8:142405091-142405113 GCCCCACAGCAAGTCAGGGAAGG + Intergenic
1049578982 8:143402337-143402359 GTTACTCAGCACCACAGGGAAGG - Intergenic
1049609914 8:143550114-143550136 GGCCCAGAGCACCCCTGGGGGGG - Intergenic
1050113846 9:2242724-2242746 TGCCCTCAGCACCTCAGGGAGGG - Intergenic
1050348599 9:4718052-4718074 AGCCCAGAGCACCACTCGGATGG - Intronic
1050420944 9:5464729-5464751 GGCCCACAGTAGAACATGGAAGG - Intronic
1050606421 9:7305965-7305987 GAACCACAGCAGCACAGGAAAGG - Intergenic
1051990501 9:23146463-23146485 GGCTCACAGCTCCACATGGCTGG + Intergenic
1052179327 9:25505280-25505302 GCCCCACAGAACCACAGGGGTGG - Intergenic
1052366145 9:27614540-27614562 GGGACAGAGCACCTCAGGGAAGG - Intergenic
1052932357 9:34066255-34066277 CGCCCACAGCACACTAGGGAGGG + Intergenic
1053464438 9:38295124-38295146 TGCCCACAGCCCCACAGAGAGGG + Intergenic
1053715505 9:40884388-40884410 GGCCCTCTGCAGCCCAGGGATGG + Intergenic
1054077039 9:60546349-60546371 GGCCCTCTGCAGCCCAGGGATGG - Intergenic
1055438888 9:76319740-76319762 GAAGCACAGCACCACAGGGAGGG - Intronic
1055950402 9:81724801-81724823 GGCACACAGCTGCACAGGGCAGG + Intergenic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1056658460 9:88527636-88527658 GGCCCAGGACACCAAAGGGAGGG - Intergenic
1058294925 9:103294508-103294530 GAAGCACAGCACCACAGGGAGGG + Intergenic
1058525391 9:105852499-105852521 GACTCACAGTTCCACAGGGATGG + Intergenic
1059247554 9:112861681-112861703 GGCCCACAGCGGCACGGAGAGGG - Intronic
1059601305 9:115782397-115782419 GGCTCACAGCTCCACATGGCTGG - Intergenic
1059718910 9:116939740-116939762 AGCTCACAGCTCCACAGTGAAGG + Intronic
1060596563 9:124852399-124852421 CTCCCACAGCAGGACAGGGAGGG - Intergenic
1061041814 9:128144956-128144978 AGCCCCCAGCACCCCAGGAAAGG - Intergenic
1061066285 9:128279681-128279703 GAAGCACAGCCCCACAGGGAGGG + Intronic
1061184122 9:129042218-129042240 GCCCCAGAGCACCTCAGGGACGG - Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061480476 9:130895594-130895616 GGCACACAGAAGCACAGGGAGGG - Intergenic
1061633634 9:131890749-131890771 TGCCCACAGCCACACAGGGCTGG - Intronic
1061946587 9:133911869-133911891 GGCCCAGAGCCCCACAGGTCAGG + Intronic
1062279646 9:135746310-135746332 GGCCCACAGCCCCTCGGTGAGGG + Intronic
1062567985 9:137171703-137171725 GCCCGCCAGCACCACAAGGAGGG + Exonic
1062596935 9:137303761-137303783 GGCCCCCAGCAGAACAGAGATGG + Intergenic
1062665938 9:137671866-137671888 GGACCACAGCACTGCAGGGTTGG - Intronic
1203627979 Un_KI270750v1:42890-42912 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1187407079 X:19013984-19014006 GGCCCGAGGCACCACTGGGATGG + Exonic
1187845053 X:23525977-23525999 GAACCACAGCAACACAGGGCTGG + Intergenic
1188561198 X:31470756-31470778 GGGACAGAGCACCACGGGGAAGG - Intronic
1190169417 X:48100034-48100056 GGTCCACAGCATCCCAGGGTAGG + Intergenic
1190511474 X:51177757-51177779 GAAGCACAGCACCACAGGGAGGG + Intergenic
1192634369 X:72803961-72803983 TGCCCGCAGCATCACAGGGTGGG - Intronic
1192647341 X:72916840-72916862 TGCCCGCAGCATCACAGGGTGGG + Intronic
1192878636 X:75258656-75258678 GGGACAGAGCACCTCAGGGAAGG + Intergenic
1194800795 X:98269853-98269875 GGACCACAGGACCACAGGACCGG - Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1199525872 X:148791234-148791256 GACTCACAGCACCACATGGCTGG + Intronic
1199671078 X:150148822-150148844 GGGCCACAGCACCACAGTGGTGG - Intergenic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic
1200212780 X:154354286-154354308 GCCCCACTGCCCCACAGGGGAGG - Exonic
1200960534 Y:8992009-8992031 GGCAAACAGCAAAACAGGGATGG + Intergenic