ID: 1185292523

View in Genome Browser
Species Human (GRCh38)
Location 22:50034358-50034380
Sequence TCGGCCCCGGGACTTGGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185292510_1185292523 30 Left 1185292510 22:50034305-50034327 CCGTTGGTGGCTATGAACGCGGT 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 84
1185292518_1185292523 -9 Left 1185292518 22:50034344-50034366 CCAGGGGACTCACCTCGGCCCCG 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 84
1185292516_1185292523 -4 Left 1185292516 22:50034339-50034361 CCGCACCAGGGGACTCACCTCGG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185292523 Original CRISPR TCGGCCCCGGGACTTGGCCG CGG Exonic
901010476 1:6199154-6199176 TCGTCCCCGAGTCTTGGCCGTGG + Intronic
901793104 1:11664611-11664633 CCGGCCTCGGGATGTGGCCGGGG - Intronic
902377504 1:16036735-16036757 GCGGCCTCGGGCCATGGCCGTGG + Intergenic
902382678 1:16059993-16060015 GCGGCCTCGGGCCATGGCCGTGG + Exonic
904256943 1:29260115-29260137 TCTGCCCGGGGGCGTGGCCGTGG + Intronic
920920284 1:210292623-210292645 TCTGCCCCGGGACTGGGCCCTGG + Intergenic
1065147108 10:22780773-22780795 TCAGCCCTGGGACTGGGCTGGGG + Intergenic
1076717636 10:132374477-132374499 TCTGCCCAGGGGATTGGCCGTGG + Intronic
1078509076 11:11972466-11972488 TCTGCCCCAGGACTTGCCTGGGG - Intronic
1081804982 11:45885610-45885632 GCGCCCCCGGGACCCGGCCGGGG - Intergenic
1083389517 11:62337676-62337698 TCGGCGCCGGGGCTTGGAGGCGG + Intronic
1089694942 11:120211147-120211169 TCCGCCGGGGGCCTTGGCCGCGG - Exonic
1092247947 12:6873602-6873624 ACTGCCCCGGGCCTTCGCCGTGG - Intronic
1097224504 12:57469434-57469456 TGGGCCCCAGGGCTTGGCTGTGG - Exonic
1101482153 12:105108141-105108163 GCTGCCCCGGGGCTTGGGCGGGG + Intronic
1103595465 12:122022298-122022320 CGGGCCCCGGGACTTGGCGAGGG + Intronic
1106087584 13:26557586-26557608 GCGGCCCCGTGAGTTGGCCCTGG + Intergenic
1106421219 13:29587836-29587858 ACAGCCCCAGGACTTGGCTGCGG + Intronic
1111908581 13:94284227-94284249 TCGGCCCTGGGACTTGGAAAAGG - Intronic
1112366802 13:98762171-98762193 CCGCCCCCTGGACTTGGCCTTGG - Intergenic
1122056168 14:99099633-99099655 TCGTCCTCGGGGCTTGGCCCTGG - Intergenic
1122458786 14:101878649-101878671 GCGGGCACGAGACTTGGCCGTGG + Intronic
1123412874 15:20073935-20073957 TGGGACCCGGGACTTGGTAGAGG + Intergenic
1123522216 15:21081048-21081070 TGGGACCCGGGACTTGGTAGAGG + Intergenic
1128506660 15:68277783-68277805 GCGGCGCCGGAACTTGGGCGGGG - Exonic
1128995151 15:72289809-72289831 TCGGCCCCGGGCCGGGGCCAGGG - Intronic
1132316079 15:100891514-100891536 ACGGCCCAGTGACTTGGCCAAGG - Intronic
1132399714 15:101497839-101497861 TCGGCCCAGGGACGTAGCAGGGG - Intronic
1132856582 16:2047758-2047780 TGGGACCCGGGGCTGGGCCGCGG - Exonic
1140476720 16:75242703-75242725 TGGGACCCGGGACTTGGTAGAGG + Exonic
1146271387 17:31487993-31488015 TGGGCCCCGGGACTCGGGGGCGG - Intronic
1160695663 19:483227-483249 TGGGGCCCTGGACTGGGCCGTGG - Intergenic
1161677648 19:5661457-5661479 TCAGCCCTGGGACCTGGCTGGGG + Intronic
1162031647 19:7920183-7920205 TCGGCACCGGAACTGGGGCGGGG - Intergenic
1164695624 19:30241484-30241506 TCTGCGCCTGGACTTGGCGGTGG + Intronic
1166984132 19:46649548-46649570 GCGCCCCCGGGACTGGTCCGGGG + Exonic
1166999583 19:46738029-46738051 TCGGCCCCGGGGCTGGGGAGGGG - Intronic
927242187 2:20928805-20928827 TGGGCCCCTGGACCTGGCCCAGG + Intergenic
927809376 2:26173128-26173150 GCGGCCCCGGGAGGTGGCGGCGG + Exonic
929501348 2:42493837-42493859 TCGGCCCCGCGGCTTGGGAGAGG - Exonic
929788750 2:45009334-45009356 GCGGCCCCCGGGCTTGGGCGAGG - Exonic
931665978 2:64609649-64609671 TTGGCCCCAGGACTGGGCCCAGG - Intergenic
1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG + Exonic
1180108708 21:45637555-45637577 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108725 21:45637611-45637633 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108742 21:45637667-45637689 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108759 21:45637723-45637745 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108776 21:45637779-45637801 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108793 21:45637835-45637857 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108810 21:45637891-45637913 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1181033042 22:20157424-20157446 ACGGCCCCGGGACAGTGCCGGGG - Intergenic
1182357566 22:29729238-29729260 TGGGCCCAGTGACTTGGCCAGGG + Intronic
1183327907 22:37204428-37204450 CCGGCCCTGGGACTTGGTCTGGG - Exonic
1184233097 22:43168979-43169001 TGGGGCCCGGGACTTGGGCAGGG - Intronic
1184430239 22:44438193-44438215 CCAGCCCCAGGACCTGGCCGAGG - Intergenic
1184999616 22:48237391-48237413 ACGGCACCGTGACTTGGCGGGGG + Intergenic
1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG + Exonic
950652993 3:14419248-14419270 TCGGCCCCCTGACATGGCAGGGG + Intronic
953797419 3:45995945-45995967 TCGGTCCGGGGACTGGGCGGTGG - Intergenic
959180978 3:102980152-102980174 TTGGCCCAGGGCCTTGGCCCAGG + Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
975116675 4:70688198-70688220 ACGCCCCCGGGACTTCTCCGGGG + Intergenic
988676786 5:33440985-33441007 TAGCGCCCGGGACTTGGCCTCGG - Exonic
995754138 5:115484458-115484480 TAGGCCCCGAGACTTGGTGGTGG - Intergenic
995831722 5:116361700-116361722 ACGCTCCCGGGACTTGGCCACGG + Intronic
1002421828 5:179153049-179153071 TCAGCCCTGGCACTTGGCCCTGG + Intronic
1002710478 5:181192023-181192045 ACCGCCCCGGGCCTTGGGCGGGG + Intergenic
1004069884 6:12288474-12288496 TGGGCCCCGGGGCTAGGCTGAGG + Intergenic
1007082076 6:39114843-39114865 TCGGCCCTAGGACCTGGCCTCGG - Intronic
1008123607 6:47645122-47645144 TAGGCCCCTGGCCTTGGCCAGGG - Intergenic
1011113061 6:83859751-83859773 CCGGCCCCGGGCCCTGCCCGGGG - Exonic
1011503854 6:88019919-88019941 TCGGCCTCCGGACTTGGACTGGG - Intergenic
1017002418 6:150005408-150005430 TCGGCCCCGCGGCTTGGTGGCGG + Intergenic
1018628725 6:165804784-165804806 ACGGCCCCGGGGCCGGGCCGCGG + Intronic
1019606810 7:1914069-1914091 TCGGGCCTGGGACCTGGACGCGG - Intronic
1020256299 7:6504511-6504533 TCGGGCCAGGGACTAGGGCGGGG + Intronic
1025990620 7:66494045-66494067 GCGTCCCCGGGACCTGGCTGGGG - Intergenic
1032474921 7:132205057-132205079 TCGGACCCTGGCCTTGGCCCGGG - Intronic
1033361475 7:140641162-140641184 TCGGCACCGGGCCGGGGCCGGGG + Intronic
1034967812 7:155402359-155402381 CCTGCCCTGGGACTTGGCCTTGG - Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1051897725 9:22006040-22006062 TCTGCCCGTGGACTTGGCCGAGG - Exonic
1059191563 9:112332910-112332932 GCCGCCGCGGGACTTGGCCGAGG - Exonic
1060478139 9:124000187-124000209 GCGGCCCCGGGCCAGGGCCGGGG - Intergenic
1060855989 9:126915169-126915191 CCGGCGCCGGGGCCTGGCCGGGG + Intronic
1062631556 9:137465333-137465355 TGGGCCCTGGGAACTGGCCGGGG - Intronic
1062711895 9:137979505-137979527 TGGGCCCAGTGACTGGGCCGGGG + Intronic
1197605675 X:128582332-128582354 TTGGCCCAGGAACTTGGCCCTGG - Intergenic
1201395571 Y:13544255-13544277 TCGGCCTGGGGCCTTGGCCCTGG + Intergenic