ID: 1185294084

View in Genome Browser
Species Human (GRCh38)
Location 22:50044890-50044912
Sequence TCTCCCCAAAGGGGCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185294084_1185294099 17 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294099 22:50044930-50044952 TGGTGGCCGTGGGGTGGGGCAGG 0: 1
1: 0
2: 15
3: 175
4: 1171
1185294084_1185294095 8 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294095 22:50044921-50044943 GCGGCATCGTGGTGGCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1185294084_1185294093 6 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294093 22:50044919-50044941 CTGCGGCATCGTGGTGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 95
1185294084_1185294096 11 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294096 22:50044924-50044946 GCATCGTGGTGGCCGTGGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 226
1185294084_1185294091 -3 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294091 22:50044910-50044932 AGACTCAGGCTGCGGCATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 83
1185294084_1185294092 0 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294092 22:50044913-50044935 CTCAGGCTGCGGCATCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 123
1185294084_1185294098 13 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294098 22:50044926-50044948 ATCGTGGTGGCCGTGGGGTGGGG 0: 1
1: 0
2: 6
3: 50
4: 342
1185294084_1185294094 7 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294094 22:50044920-50044942 TGCGGCATCGTGGTGGCCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1185294084_1185294097 12 Left 1185294084 22:50044890-50044912 CCCACGGGGCCCCTTTGGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1185294097 22:50044925-50044947 CATCGTGGTGGCCGTGGGGTGGG 0: 1
1: 0
2: 3
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185294084 Original CRISPR TCTCCCCAAAGGGGCCCCGT GGG (reversed) Intronic
900514120 1:3073221-3073243 CCTCCCCTGAGGGGCCCGGTGGG - Intronic
905791698 1:40792954-40792976 CCTCCCCAAGGGGCCCCTGTGGG + Intronic
905851691 1:41279544-41279566 TCTCCCCAAAGGAACCCCAAAGG - Intergenic
912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG + Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
922950563 1:229555421-229555443 CCTCCCCAAAGGGGCGGCTTAGG + Intronic
924643686 1:245857509-245857531 TCAGCCCAAAGGGGCAACGTAGG - Intronic
1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG + Intronic
1084596613 11:70120445-70120467 TCTCCCCAACAGGGCCCAGGTGG - Intronic
1089746968 11:120624308-120624330 TCTGCCCCATGGGGCCCCATGGG - Intronic
1090142314 11:124277772-124277794 TCTCCCCAAGGGTGCCCCACAGG + Intergenic
1091613050 12:2027907-2027929 TCTCCCAAGAGGGGCCCACTGGG + Intronic
1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG + Intergenic
1095719514 12:45385556-45385578 ACTCCCCAAAGAGACCCTGTTGG - Intronic
1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG + Intronic
1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG + Intergenic
1104935360 12:132361416-132361438 GCTCCCCAAGGCGGCCCTGTTGG + Intergenic
1106412035 13:29517239-29517261 TCTCACCAAAGGGGCGCTGTGGG - Exonic
1107717124 13:43211424-43211446 ACTCCCCCAAGTTGCCCCGTAGG + Intergenic
1113369297 13:109707830-109707852 TCTCCCCACCTGGGCTCCGTAGG - Intergenic
1116844549 14:49853119-49853141 TTTCCCCACAGGGGGGCCGTAGG + Exonic
1118437181 14:65782287-65782309 TCTCCTCAAAAGGGTCCCTTTGG + Intergenic
1118835588 14:69475675-69475697 GCTTCCCACAGGGGCCCCGGGGG + Intergenic
1119148055 14:72334128-72334150 TGTCCAGAAAGAGGCCCCGTGGG + Intronic
1119438252 14:74611823-74611845 CATGCCCAAAGGGACCCCGTAGG - Exonic
1121610643 14:95276445-95276467 TCTCCCCAAAGGGGGAACTTGGG + Intronic
1128532629 15:68464987-68465009 TCTCCCCAGAGGGCCCCGGCTGG + Intergenic
1133581620 16:7149824-7149846 ACTCCCCAAAGGCTCCCAGTCGG + Intronic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1145251460 17:21298990-21299012 TCCCCCCAAAGTGGCCCTGCAGG - Intronic
1148605599 17:48926957-48926979 TCTCTCCAAAAGGGTCCTGTGGG - Exonic
1152656637 17:81522979-81523001 AGTCCCCAAAGGGACCCCGAGGG - Intronic
1160452151 18:78973510-78973532 TCTCGCCAAAGGCGTCCCGCGGG - Intergenic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1161343271 19:3754090-3754112 TCTCCCCATCGGGGGCCTGTGGG + Exonic
1161591894 19:5132734-5132756 TCTCACCAAAGGGTCACAGTGGG - Intronic
1167589915 19:50398889-50398911 TGCCCCCAAAGCGGGCCCGTGGG + Exonic
925141215 2:1550905-1550927 TCTCCCCAAAGCGGAGCCTTAGG + Intergenic
927697166 2:25246504-25246526 CCTCCACAGAGGGGCCCAGTGGG - Intronic
934556055 2:95287543-95287565 TCACCCCCAAGGGGCTCCGGGGG - Intronic
936985949 2:118311318-118311340 CCTCCCAAAAGAGGCCACGTGGG - Intergenic
937677726 2:124610027-124610049 CCTCCCCAAAGGAGACCAGTTGG - Intronic
938310445 2:130285614-130285636 TCTCCCCAAAGGGACCCCCAGGG + Intergenic
938444483 2:131366756-131366778 TCTCCCCAAAGGGACCCCCAGGG - Intergenic
947542067 2:230986385-230986407 TCTACCCAAAGGGGCCTCAGGGG + Intergenic
947618532 2:231574109-231574131 CCGCCCCAAAGAGGCCTCGTTGG + Intergenic
1170243167 20:14192676-14192698 TCTCCCCACAAGGGCCACTTGGG + Intronic
1170605135 20:17870018-17870040 TCTCCCCGAAAGGGCCCCTGAGG + Intergenic
1173284461 20:41657660-41657682 TCTCCCCTTAGGGGACCAGTTGG - Intergenic
1173372341 20:42448279-42448301 TCTCCTCAAAGGGCCCCCCTTGG + Exonic
1175261943 20:57680239-57680261 ACTCCCCAAAGCGGCTCCTTGGG - Intronic
1175868908 20:62198042-62198064 TCAAGCCACAGGGGCCCCGTGGG - Intronic
1176087964 20:63306679-63306701 TCTGCCCATAAGGCCCCCGTAGG + Intronic
1182030796 22:27157773-27157795 TCTCCCAACAGGGACCCAGTTGG + Intergenic
1182519681 22:30878325-30878347 TCTGCCCAAGGGGCCCCCGAAGG - Intronic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
949905101 3:8852543-8852565 TTCCCCCAGAGGGGCCCAGTGGG - Intronic
950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG + Intergenic
951840627 3:27030064-27030086 GCTGCGCAAAGGGGCCCAGTGGG + Intergenic
954414289 3:50385401-50385423 TCTCCCCCATGGGTCCACGTGGG + Intronic
968831083 4:2933347-2933369 TCTCTCCATTGGGGCCCCCTCGG - Intronic
969446059 4:7245225-7245247 TCTACCCAAAGAGACCCTGTTGG - Intronic
972679885 4:41295118-41295140 TCTCCTCCAAGGGGCCTGGTTGG + Intergenic
985745434 5:1644079-1644101 CCATCCCAAAGGGGCCCCTTTGG + Intergenic
989776116 5:45208628-45208650 TCTCCCCAATGGGACCTGGTGGG - Intergenic
990336199 5:54775017-54775039 CCTCCCCAAAGGGGCCATGTTGG - Intergenic
997410781 5:133689144-133689166 TCTCTCCACAGTGGCCCGGTTGG + Intergenic
1015496573 6:133889539-133889561 TCTCCCCAGAAGGGCCGCGGCGG + Exonic
1016863889 6:148747477-148747499 GCCCCCCATAGGGGCCCCATGGG - Exonic
1018172814 6:161155113-161155135 ACTCCCCAGAGGGGACCTGTGGG - Intronic
1018275140 6:162122334-162122356 TCTCCCAGAAGGGGCCTCTTAGG + Intronic
1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG + Intergenic
1019306911 7:339939-339961 TCTTCCCACAGGGGCCTCGGAGG + Intergenic
1021434539 7:20599322-20599344 CCTCCCCAAAGCTGCCCGGTAGG - Intergenic
1029640636 7:101817038-101817060 TTTCCCCAAAGAGCCCCCGCGGG - Intronic
1029689801 7:102173824-102173846 TCTCCCCAGAGCAGCCCCGTGGG + Intronic
1030492497 7:110255307-110255329 ACTCCCCAAAAGGCCCCAGTGGG + Intergenic
1034529661 7:151687914-151687936 CCTCCCCAACGGGGCTCCCTCGG + Intronic
1038324993 8:26566334-26566356 CCTCCCTAAAGGGGCCCTGCAGG + Intronic
1049781808 8:144432534-144432556 TTTCCCCAAAGGGGTCCTGAGGG - Intronic
1049865391 8:144932336-144932358 TCTCCCCTAAGGGGCCCCTAAGG + Exonic
1056432326 9:86540185-86540207 CCTCCCCAAATGGGACCAGTGGG + Intergenic
1057090125 9:92250459-92250481 TCTCCCCAAGGAGCCCCCATGGG + Intronic
1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG + Intronic