ID: 1185295030

View in Genome Browser
Species Human (GRCh38)
Location 22:50048994-50049016
Sequence CAGTGTGGGTGGAGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1092
Summary {0: 1, 1: 0, 2: 12, 3: 111, 4: 968}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185295015_1185295030 24 Left 1185295015 22:50048947-50048969 CCGGGCCTCAGTGCCCTCAGCTT 0: 1
1: 0
2: 5
3: 97
4: 672
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295018_1185295030 10 Left 1185295018 22:50048961-50048983 CCTCAGCTTCCACATGCGCACAG 0: 1
1: 0
2: 1
3: 36
4: 280
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295017_1185295030 11 Left 1185295017 22:50048960-50048982 CCCTCAGCTTCCACATGCGCACA 0: 1
1: 0
2: 0
3: 15
4: 236
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295014_1185295030 28 Left 1185295014 22:50048943-50048965 CCTGCCGGGCCTCAGTGCCCTCA 0: 1
1: 0
2: 4
3: 52
4: 465
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295013_1185295030 29 Left 1185295013 22:50048942-50048964 CCCTGCCGGGCCTCAGTGCCCTC No data
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295016_1185295030 19 Left 1185295016 22:50048952-50048974 CCTCAGTGCCCTCAGCTTCCACA 0: 1
1: 1
2: 4
3: 44
4: 483
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968
1185295020_1185295030 1 Left 1185295020 22:50048970-50048992 CCACATGCGCACAGCAGGCCAGC 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG 0: 1
1: 0
2: 12
3: 111
4: 968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185295030 Original CRISPR CAGTGTGGGTGGAGGGGAGC TGG Intronic
900069966 1:763339-763361 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
900101805 1:965107-965129 CAGTGTGGGTGTGGCGGTGCTGG + Exonic
900226263 1:1534924-1534946 CAGCTTGGGCGGAGGGGAGGGGG - Intergenic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900433242 1:2612675-2612697 CAGTGAGGGTGGAGGGGCTAGGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900853633 1:5163276-5163298 CAGTATGAGTGGAACGGAGCCGG - Intergenic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
901013067 1:6211831-6211853 CAGTGTGGATGCAGGGGGGTGGG - Intronic
901506734 1:9689834-9689856 CAGGGTCGGTGGAGGCGATCAGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902470803 1:16646712-16646734 GAGTGGGGGTGGAGAGGGGCAGG + Intergenic
902487997 1:16760736-16760758 GAGTGGGGGTGGAGAGGGGCAGG - Intronic
902616701 1:17627569-17627591 TAGTGTGGGTGGCGTGGGGCAGG - Intronic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902723920 1:18322872-18322894 CGGAATGGGTGAAGGGGAGCGGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902890607 1:19440603-19440625 CAGTGTGGGGGGAAGGGACTTGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903009843 1:20321845-20321867 CAGAGTGGGTAGAGAGGAGGTGG + Intronic
903351284 1:22718123-22718145 CACAGTGGGTGGGGGAGAGCTGG - Intronic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903589158 1:24441127-24441149 CAGTGCTGGTGGAGTGAAGCCGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904267349 1:29325526-29325548 TATTGTGGGGGGAGGGGAACGGG - Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
905093047 1:35445100-35445122 CAGTGTGGCTGGGTGGGACCTGG + Intronic
905209287 1:36362340-36362362 CAGTGTGGGTGCAGGGCTCCGGG + Intronic
905428298 1:37901853-37901875 CAGAGTGGGAGTAGGGAAGCAGG - Intronic
905495199 1:38379512-38379534 CAGTCTTGGTGTAGCGGAGCAGG - Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906191423 1:43901794-43901816 CAGGGTGGGTGGGGGTGAGTGGG + Intronic
906293604 1:44635698-44635720 TAGTGTCGGGGGAAGGGAGCGGG - Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
906504922 1:46371809-46371831 AAGTGGGGGTGGAGGTGGGCGGG + Intergenic
906606256 1:47174460-47174482 CAGTGTGTGTGGAGGGGCGTGGG - Intergenic
907323066 1:53617884-53617906 CAGAGTGAGTGGGGGTGAGCAGG + Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908432349 1:64071560-64071582 CTGTGTGGGTGGTGGGGCGGGGG - Intronic
909059180 1:70860041-70860063 TAGAGTGGGTGGGGGGGAGTGGG + Intronic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909894168 1:81045546-81045568 CATTGTGGGTGGTGGAGAGCTGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910214358 1:84828003-84828025 AAGAGGGGGTGGAGGGGAGGAGG + Intronic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
910258261 1:85271455-85271477 CAGTCTTGGTGGAAGGGAGATGG + Intronic
910330315 1:86065864-86065886 CAGTGGGGGTAGGAGGGAGCTGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910444049 1:87282714-87282736 AAGAGTTGGGGGAGGGGAGCTGG - Intergenic
910981163 1:92961279-92961301 CAGGGAGGGAGGAGGGGAGCGGG + Intronic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912560704 1:110549451-110549473 CAAGGTGGGAGGTGGGGAGCAGG + Intergenic
912679727 1:111721405-111721427 CATGGTGGGTGGAGGCGAGTTGG + Intronic
913701724 1:121380935-121380957 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
914042284 1:144061404-144061426 GAGTGTGGGTGGAGGGGGTGTGG - Intergenic
914135805 1:144899084-144899106 GAGTGTGGGTGGAGGGGGTGTGG + Intronic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914824592 1:151132203-151132225 CAGCTTGGCTGGAAGGGAGCGGG + Exonic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915341588 1:155179507-155179529 GAGTGTGGGTGAGAGGGAGCTGG - Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916091399 1:161310119-161310141 TAGTCTGGGTGGAGGGGTGGGGG + Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916744163 1:167671475-167671497 GAGTGAGTGTGGAGGAGAGCAGG - Intronic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
919199613 1:194338288-194338310 TTGTTTGGGTGGAGTGGAGCTGG + Intergenic
919353372 1:196489054-196489076 AAGTGTGGGTTGTGAGGAGCAGG + Intronic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920232627 1:204480679-204480701 CTGTGTGGGTGGTGGGCTGCCGG + Intronic
920366454 1:205450585-205450607 GAGGGTGGGTGGAGGGGGCCAGG - Intronic
920489148 1:206399655-206399677 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
920528229 1:206684509-206684531 TCGTGGGGGTGGGGGGGAGCTGG - Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
922203680 1:223428563-223428585 CAGTGTGAGAGCAAGGGAGCAGG + Intergenic
922265672 1:223981375-223981397 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
922469434 1:225866829-225866851 CACTGTGGGCTGAGGGGTGCTGG - Intronic
923051653 1:230394628-230394650 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051685 1:230394741-230394763 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924347510 1:243086327-243086349 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
924382182 1:243475049-243475071 CAGCCTGGGAGGAGAGGAGCTGG + Intronic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
1062885193 10:1010960-1010982 CAGTCAGGATGGAGGGGTGCAGG - Intronic
1063614643 10:7591315-7591337 CAGGGTGGGTTTAGGGAAGCTGG - Intronic
1063721275 10:8584089-8584111 GGCTGTGGGTGTAGGGGAGCAGG + Intergenic
1063777273 10:9278115-9278137 CAGCGGGGGAGCAGGGGAGCTGG + Intergenic
1064691603 10:17924147-17924169 CCATGTGGGTAGAGAGGAGCAGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065500983 10:26382096-26382118 CAGTGTTGGGGGAAGGGACCTGG + Intergenic
1065651504 10:27897222-27897244 GAGTGTAGGTGGAAGGGAGAAGG - Intronic
1065668469 10:28087806-28087828 CAGTGAGGTGGGAGAGGAGCAGG + Intronic
1065768078 10:29050629-29050651 AAGTGTGGGAGGATGGGAGAGGG - Intergenic
1066243119 10:33556852-33556874 CAGGGTGAGCGGAGGAGAGCTGG + Intergenic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1066728843 10:38418543-38418565 AGATGTGGGTGGAGGTGAGCTGG + Intergenic
1067045181 10:42981414-42981436 CAGCGTGGGGGCAGGCGAGCTGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067809773 10:49417826-49417848 CAGACTGGGAGAAGGGGAGCAGG - Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1068131904 10:52905671-52905693 GTGTGTGGGTCGAGGGGAGGAGG + Intergenic
1068685210 10:59863557-59863579 AAGGGTGGGTGGTGGGGAGAGGG + Intronic
1068891953 10:62157081-62157103 CAGTGCGGGGGAGGGGGAGCAGG + Intergenic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069727052 10:70586779-70586801 CAGTGTGTGTGGTGGGGGGTTGG + Intergenic
1069729416 10:70601206-70601228 AACTGTGGGTGGTGGGGAGGGGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070370030 10:75773440-75773462 CTGTGTGGGTCCAGTGGAGCAGG + Intronic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071252716 10:83837345-83837367 TATTTGGGGTGGAGGGGAGCAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071567907 10:86681049-86681071 CAGTGTGGGGTCAGTGGAGCAGG + Intronic
1071816333 10:89235502-89235524 CAGTGTGGGTGGAAGCCAGGAGG + Intronic
1072187866 10:93059944-93059966 GGGTGTGTGTGGAGGGGTGCAGG - Intergenic
1072390200 10:94976604-94976626 TAGTGTGGGGGGAGGGGAGGTGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072811619 10:98466974-98466996 AGGTGGGGGTGGAAGGGAGCTGG - Intronic
1072987584 10:100155171-100155193 GAGAGTGGGTGGAGGAGAGAAGG - Intronic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1073911156 10:108346285-108346307 GAGGGTGGGTGGAGTGGAGCTGG + Intergenic
1074051220 10:109882808-109882830 CAGATTGGGTGGATGGGGGCAGG - Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074375876 10:112940450-112940472 GGTTGTGGGGGGAGGGGAGCGGG - Intergenic
1074752283 10:116598174-116598196 CATGGTGGGGTGAGGGGAGCAGG + Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074895127 10:117770801-117770823 CTGTCTGGTTGGAGAGGAGCTGG - Intergenic
1075089638 10:119436518-119436540 CCATCTGGGTGCAGGGGAGCAGG + Intronic
1075203159 10:120423093-120423115 TAGTGTGGGTGGGTGGGTGCTGG + Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075518026 10:123125016-123125038 GAGTGAGGCTGGATGGGAGCAGG - Intergenic
1076064974 10:127441689-127441711 CAGTGGGGGTGGTGGGGGGGTGG - Intronic
1076078281 10:127554927-127554949 CAGGGTGTGTGGAGTGGGGCAGG + Intergenic
1076936518 10:133569579-133569601 CACGGCGGGTGGAGCGGAGCCGG - Intronic
1077126764 11:942949-942971 CAGTGAGCGAGGAGAGGAGCTGG + Intronic
1077136837 11:1004005-1004027 CAGAGGGGGTGGCGGGGAGGTGG + Intronic
1077275574 11:1705777-1705799 CAGTGTGGTGGGTGGGGGGCTGG + Intergenic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078367005 11:10715178-10715200 CAGGGTCAGTGGAGGAGAGCAGG + Intergenic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1079240815 11:18721156-18721178 CATTGTGGGTGGCGAGGTGCCGG - Intronic
1079317580 11:19422224-19422246 CAGTCTGGGGGGCGGGGAGCGGG + Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1081548217 11:44087662-44087684 CAGTGTATGTGGTGGGGAGAGGG + Intergenic
1081582720 11:44363461-44363483 CAGTGTGGGTTGTGAAGAGCTGG + Intergenic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1083549298 11:63574265-63574287 CAATGTGGGAGGAGAGGAGCAGG + Exonic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083891044 11:65595859-65595881 CTGTGTGGGTGGCTGGGACCCGG + Exonic
1083894130 11:65611696-65611718 CAGTGGGGAGGGTGGGGAGCAGG + Intronic
1083922436 11:65787875-65787897 CACTTTGGGGGGCGGGGAGCGGG + Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084174510 11:67416331-67416353 CAGGGTGGGGGTGGGGGAGCTGG - Intronic
1084204797 11:67585113-67585135 GGGGTTGGGTGGAGGGGAGCAGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084353982 11:68624604-68624626 CAGGGTGTGAGGAGGGGAGGTGG - Intergenic
1084494891 11:69498001-69498023 AAGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084494902 11:69498041-69498063 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084494972 11:69498301-69498323 AAGTGTAGGTGGAGAGGTGCAGG + Intergenic
1084495021 11:69498501-69498523 AAGTGTAGGTGGAGAGGTGCAGG + Intergenic
1084495032 11:69498541-69498563 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084495038 11:69498561-69498583 AGGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084495071 11:69498681-69498703 GGGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084495087 11:69498763-69498785 GAGTATAGGTGGAGGGGTGCAGG + Intergenic
1084564806 11:69922643-69922665 TAGTGTGGGGCAAGGGGAGCTGG - Intergenic
1084684863 11:70687584-70687606 CAGTGTGGGGGTAGGGGGGTGGG + Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085322620 11:75583969-75583991 CAGTGCGGGAGGAGGGGCTCTGG - Intergenic
1085882255 11:80481353-80481375 TAGGGTGACTGGAGGGGAGCTGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087012670 11:93528660-93528682 CAGAGTGGGTGGAGAGGTGAAGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089352556 11:117829676-117829698 CGGTGTGGGTGGGGGGGATTTGG - Intronic
1089577272 11:119454027-119454049 GAGGGTGGGTGGCTGGGAGCAGG + Intergenic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1090877835 11:130806797-130806819 CAGGGTGGGAGGAGGGGAATGGG - Intergenic
1091446390 12:546216-546238 GGGTGTGGGAGGAGGGGAGTGGG + Intronic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091796682 12:3301248-3301270 GAGTGAGGATGAAGGGGAGCAGG + Intergenic
1091814743 12:3429132-3429154 CACTGTGGGTGGGGCGGAGGGGG + Intronic
1091823186 12:3491349-3491371 CAGCGCGGGTGGAGAGGGGCGGG + Exonic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1094041564 12:26125289-26125311 GAGTGGGGGTGCAGGGGTGCGGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094497570 12:30998068-30998090 TAGTGATGGTGGAGGGGAGCAGG - Intergenic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1094797298 12:33990384-33990406 GTGTGTGGGCGGTGGGGAGCGGG - Intergenic
1095166065 12:38973602-38973624 CAGTTGGGGAGTAGGGGAGCGGG - Intergenic
1095248136 12:39946249-39946271 CAGTGGAGGTTGTGGGGAGCAGG + Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098367363 12:69718840-69718862 GAGTGGGGGTGAAGGGGGGCGGG + Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098818087 12:75193755-75193777 CAGGGTGGGTGGATAGGAGCAGG - Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100861031 12:98807332-98807354 AAATGTGGGGGGAGGTGAGCTGG - Intronic
1101132871 12:101707284-101707306 CTTTGTGGGTGGAATGGAGCTGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102458554 12:113086374-113086396 CAGTGTGGTTGGAGAGGCTCAGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102815515 12:115862267-115862289 AAGTGAGGGTGGAGGAGAGAGGG + Intergenic
1102914058 12:116739698-116739720 CACTGTGGGTGGACAGGAGTGGG + Intronic
1103011088 12:117458964-117458986 CAGTGTGCGTGGTGGTGTGCAGG - Exonic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103565149 12:121811707-121811729 CCCTGTGGGCGGAGGGGAGGAGG + Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1103897105 12:124279990-124280012 CAGTGTGGGTCCCGGGCAGCCGG + Intronic
1103915378 12:124373196-124373218 CAGTGTGAGTACAGGGGACCCGG + Intronic
1103915388 12:124373238-124373260 CAGTGCGTGTGCAGGGGACCCGG + Intronic
1104001477 12:124863404-124863426 CGGTGAGGGTGGTGGGGAGGCGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104971096 12:132530989-132531011 CAGTGTGGGGGGGGGGGTGCAGG + Intronic
1105230783 13:18493768-18493790 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105896223 13:24719032-24719054 GAGTGTGGGGGGAGGGTACCGGG - Intergenic
1106345473 13:28872626-28872648 CAGAGTGGGTGGGAGGGAGCTGG + Intronic
1107284863 13:38779674-38779696 GAGTGTGTGAGGAGAGGAGCAGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1108515290 13:51195806-51195828 CAGTAGGGGTGGGTGGGAGCAGG + Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1110047271 13:70845837-70845859 AAGGCTGGGTGGAGGGGAGATGG - Intergenic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1111947784 13:94683487-94683509 CAGTAGAGGTTGAGGGGAGCAGG + Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112144264 13:96680096-96680118 CAGTGTCTGTGGATGAGAGCCGG + Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1113335669 13:109373646-109373668 AATTGTGTGTGGAGGGGTGCGGG + Intergenic
1113422642 13:110182281-110182303 CAGTGAGGGTGGATGGGGCCTGG + Intronic
1113625748 13:111845242-111845264 CAGTGTCTGTGGGGCGGAGCTGG + Intergenic
1113657186 13:112074123-112074145 GAGTGTGGGTGAAGAGGAGAGGG + Intergenic
1113676786 13:112213242-112213264 CAGGGTGGGAGCAGGGCAGCAGG + Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1114524334 14:23358987-23359009 CAGTGTCGGGGTGGGGGAGCAGG + Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1118793313 14:69116010-69116032 TGGGGTGGGTGGAGGGGAGGAGG - Intronic
1119031639 14:71197325-71197347 CAGTGGGGAGGTAGGGGAGCTGG - Intergenic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1119653569 14:76400604-76400626 CAGTTTGGGTGGTGGTGAACGGG + Intronic
1119673377 14:76536734-76536756 GAGTGTGGGTGTAGGGCACCGGG - Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1119753599 14:77098379-77098401 CGGTCCGGGAGGAGGGGAGCAGG + Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119877449 14:78072952-78072974 AGGTGTGTGTGGAGGTGAGCAGG - Intergenic
1119966539 14:78922692-78922714 GCCTGTAGGTGGAGGGGAGCAGG + Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121009816 14:90513300-90513322 AATTCTGGGTGGAGGTGAGCTGG + Intergenic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121104381 14:91271073-91271095 GAGGGGGGGTGGAGGGGCGCAGG + Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121327732 14:93031256-93031278 CAGCGTGGGTGCAGGGGACGGGG + Intronic
1121333044 14:93059931-93059953 CAGTGTGGATGGGGGTGAGCAGG - Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121550354 14:94794997-94795019 CACTCTGGGTGGAGCTGAGCAGG + Intergenic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122871595 14:104641272-104641294 CAGTTAGGGTGAAGGGGACCAGG + Intergenic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124407332 15:29404398-29404420 CAGTGAGGGGAAAGGGGAGCAGG - Intronic
1124624697 15:31301189-31301211 CAGTGGGGGTGGGGAGGGGCAGG - Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127801078 15:62477913-62477935 CAGCGGGGGCAGAGGGGAGCGGG + Intronic
1127843161 15:62847492-62847514 CAGTGTGGTGGGAGGCCAGCAGG + Intergenic
1127856183 15:62955581-62955603 CAGTCTAGGTGGTGGGTAGCTGG + Intergenic
1128475532 15:67994036-67994058 CAGCCTGGGTGTAGGGCAGCAGG + Intergenic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128766718 15:70255595-70255617 CAGTGTTGGAGGTGGGGATCTGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129326544 15:74802930-74802952 CCGTGAGGGTGGGGGGGACCGGG + Exonic
1129350303 15:74952115-74952137 CAGCCTTGGTGGTGGGGAGCGGG + Intergenic
1129392044 15:75225511-75225533 TAGTGTTGGTGGGAGGGAGCTGG + Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1129826942 15:78640645-78640667 AAGCGTGGGTGCAGAGGAGCCGG - Intronic
1130306195 15:82713587-82713609 GAGTGAGGGTAGAGGGGAGTAGG - Intergenic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1132614352 16:832800-832822 CAGGGTGGATGGGGCGGAGCGGG - Intergenic
1132678638 16:1130844-1130866 CAGTGGGGGTGGGGGGGGCCGGG + Intergenic
1133080387 16:3314456-3314478 CAGTGTGGGTCTTGGGCAGCAGG - Intronic
1133091477 16:3407703-3407725 CAGTCTGGATGGAGATGAGCTGG - Intronic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1134095165 16:11414237-11414259 CAGGGTGGGTGGGGAGGACCAGG - Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134657564 16:15958727-15958749 CCCTGTGGGTGGAGTGGTGCTGG + Intronic
1135111033 16:19691098-19691120 ATGTGTGCGTGGCGGGGAGCGGG - Intronic
1135668969 16:24359056-24359078 CACGGTGGGTGGCGGGGAGTGGG - Intronic
1135828857 16:25755121-25755143 ATGTGTGGGTGGAGGGGTGGAGG - Intronic
1136364590 16:29803887-29803909 AACTCTGGATGGAGGGGAGCTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1136540122 16:30924088-30924110 CGGGGTGGGGGGAGGGGAGCTGG + Intronic
1136616555 16:31401940-31401962 CCATGTGGGAGGAAGGGAGCAGG + Intronic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138238743 16:55408923-55408945 CAGTGAGGGAGGAGGAAAGCAGG - Intronic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139202603 16:64993804-64993826 CAGAGTGGGGAGAGAGGAGCTGG + Intronic
1139365194 16:66428292-66428314 CGGCGTGGGTGGCGGGGCGCAGG + Intronic
1139560686 16:67739856-67739878 AAGTGAGGGTAGAGGGGAGTGGG + Intronic
1139578555 16:67857868-67857890 AGGTGTGGGTGGAGGGGAAGTGG + Intronic
1139936789 16:70577376-70577398 CAGAGTGGGTGGAGGTGATGGGG - Exonic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1141690283 16:85592872-85592894 CAGTGTGGGTGGGGGCGCTCTGG + Intergenic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142286862 16:89175040-89175062 CAATGTGGGTGTGGGTGAGCAGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142733868 17:1882148-1882170 CAGTGGTGGCGGAGAGGAGCTGG - Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142809523 17:2388756-2388778 GACTGAGTGTGGAGGGGAGCTGG - Intronic
1142860079 17:2755885-2755907 CCGGGTGGGCGGAGGGGCGCCGG + Intergenic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143141746 17:4745098-4745120 CAGACCGGGCGGAGGGGAGCAGG - Intronic
1143551025 17:7630606-7630628 CAGTGTGGGTTTGGGGGAGATGG - Intronic
1143570853 17:7757454-7757476 CAGTGGGGTGGGAGGGGACCTGG - Intronic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1143692088 17:8577096-8577118 CTGGGTAGGTGGCGGGGAGCAGG + Intronic
1144456411 17:15422576-15422598 AAGTGAGGGTGCCGGGGAGCTGG + Intergenic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144710512 17:17398695-17398717 CAGGGAGGGTGGCGGTGAGCTGG - Intergenic
1144836195 17:18157908-18157930 CAGTGTGGGTGGGGTGGGGCGGG + Intronic
1145271756 17:21408711-21408733 CATGGTGGGTGGAGGGGTGAAGG - Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1145309970 17:21696175-21696197 CATGGTGGGTGGAGGGGTGAAGG - Intronic
1145973144 17:28968648-28968670 TAGTTTGGGTGGAGGGGTGAGGG + Intronic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146010072 17:29187087-29187109 CAGTGTGGGGGTTGGGGAGTAGG - Intergenic
1146836767 17:36117310-36117332 GACTGTAGGTGCAGGGGAGCAGG - Intergenic
1147002924 17:37377845-37377867 CAGAGGGGGAGGAGGGGAACCGG - Intronic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484210 17:40796779-40796801 CAGAGAGAGTGGAGGAGAGCAGG - Intronic
1147677340 17:42217174-42217196 CAGTGTTGGTGGAAATGAGCTGG - Exonic
1147732995 17:42615485-42615507 CAGTGAGGGTGGGAGGGAACGGG - Intergenic
1147939890 17:44038956-44038978 CAGTGTGGGGTGGGGGGAGGCGG + Intronic
1148689688 17:49520138-49520160 CAGTGTGGGGGCAGGGGTGTTGG - Intergenic
1148786781 17:50149593-50149615 CGGTGGAGGTGGAGGAGAGCGGG - Exonic
1148863223 17:50615292-50615314 GACTGGGGGTGGAGGGGTGCGGG + Intronic
1149050709 17:52301168-52301190 TATTTTGGGTGGAGGGGAGAGGG - Intergenic
1149424964 17:56546007-56546029 GAGGGTGGGGGGAGGGGAGGAGG + Intergenic
1149610847 17:57956663-57956685 AAGTGTGGGGAGAGAGGAGCAGG - Intergenic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151242343 17:72767969-72767991 CAGTTTGGGTGAAGGGGTGGGGG + Intronic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151362072 17:73595186-73595208 GAGTGTGGGTGAAGGTGAGGAGG + Intronic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151787148 17:76280569-76280591 GAGACTGAGTGGAGGGGAGCTGG - Intronic
1151797041 17:76353444-76353466 TGGGGCGGGTGGAGGGGAGCGGG + Intronic
1151890497 17:76948317-76948339 CTGAGTGGGTGGAAGAGAGCAGG - Intronic
1152073447 17:78145288-78145310 CAGGGAGGGTGGGGGTGAGCAGG - Intergenic
1152095446 17:78269366-78269388 CAGAGTGGGGGGTGGGGGGCCGG - Intergenic
1152137300 17:78512051-78512073 CAGTGTGGTGGGGGCGGAGCAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152515428 17:80820812-80820834 CTGTGTGGGTGGTGGAGGGCAGG - Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152664146 17:81557730-81557752 CAGGAAGGGTGGAGAGGAGCTGG - Exonic
1152760149 17:82103473-82103495 CAGTGTGGGGGGTGGGGGGAGGG - Intronic
1152778387 17:82215770-82215792 CAGTGCGGGTGGCCGGGAGTTGG + Intergenic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153094358 18:1383661-1383683 CAATGCAGCTGGAGGGGAGCAGG - Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153990490 18:10394785-10394807 CGGGGTGGTTGGAGGAGAGCCGG - Intergenic
1154522618 18:15246089-15246111 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1156079529 18:33316456-33316478 GCGTGTGGGGGGAGGGGTGCGGG - Intronic
1156561129 18:38127017-38127039 TGGTGGGGGTGGAGGGGGGCAGG - Intergenic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157565477 18:48676512-48676534 CAATGTGGGGGCAGGGGAGCCGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158319646 18:56248881-56248903 GGGTGGGGGTGGAGGGGGGCAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159121844 18:64180036-64180058 GTGTGTGGGTCTAGGGGAGCTGG - Intergenic
1159871074 18:73760155-73760177 CAGGGTGGGGAGAGGTGAGCTGG - Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1159961285 18:74557529-74557551 GAGTGGGGGTGGGGAGGAGCTGG - Intronic
1160399081 18:78596068-78596090 CAGTGTGGGTGGAGCCCTGCTGG + Intergenic
1160764712 19:802317-802339 GAACGTGGGTGGAGGGGAGGCGG + Intronic
1161288449 19:3480378-3480400 CAGGGTAGGTGCAGGGGGGCGGG - Exonic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162050421 19:8029201-8029223 CAGGGTGGGGGGCGGGGGGCAGG + Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162320324 19:9967847-9967869 CAGTGAAGGGGGTGGGGAGCTGG + Intronic
1162343571 19:10106687-10106709 GAGGGTGGGTGGAGGCGGGCTGG - Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162737057 19:12752515-12752537 GGGTGTGGGTGGAGAGGTGCGGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162797156 19:13092800-13092822 CAGAGTGGGTGGGGGAGAACCGG - Intronic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1163005888 19:14396494-14396516 CCGTGAGGCTGGACGGGAGCTGG + Intronic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163722641 19:18905544-18905566 CAGTGCGGGTGGAGAGGGGCAGG + Intronic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1165072689 19:33264685-33264707 CAGTCTGGCAGGAGGTGAGCAGG - Intergenic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165422894 19:35731270-35731292 CAGTGTGGCTGTAAGGGGGCCGG - Intronic
1165466589 19:35978520-35978542 AAGTGAGGGAGGAGGGGAGTGGG - Intergenic
1165475119 19:36026091-36026113 AAGTGGGGGAGGAAGGGAGCAGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1166007743 19:39918646-39918668 CAGAGTGGGTGAAGAGGAGGTGG + Intronic
1166133991 19:40764225-40764247 CAGTGTTTGTGGTGGGGAGTTGG + Intronic
1166159786 19:40943845-40943867 CAGCGTGGGGTGAGGAGAGCAGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1167426513 19:49432463-49432485 CAGCCTGGGTGGAGCAGAGCCGG - Intronic
1167508540 19:49883763-49883785 CACTTAGGGTGGATGGGAGCAGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1168069926 19:53943480-53943502 CGGGGTGGGGGGAGGGGGGCAGG + Exonic
1168100861 19:54140237-54140259 CGGGGTGGGGGGAGGTGAGCAGG - Intronic
1168109906 19:54186530-54186552 CAGGATGTGTGGAGGGGAGCAGG - Intronic
1168179478 19:54651063-54651085 CACTGAGGGTGGAGAGGAGGGGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168718999 19:58544714-58544736 CAGGGGGGGAGGAGGGGCGCGGG - Exonic
1202703202 1_KI270713v1_random:3504-3526 GAGTGGGGGTGGAGAGGGGCAGG + Intergenic
925420658 2:3708131-3708153 CGGTGGGGGTGCAGAGGAGCTGG + Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
926163961 2:10506612-10506634 GAGTGTGGCAGGAGGGGTGCAGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927336811 2:21934388-21934410 CAGTGATGGTGGAGGGGCGTGGG - Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927863028 2:26572164-26572186 GGGGGTGGGTGGAGGGGAGATGG - Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928145480 2:28771035-28771057 AAGGGTGGGGGGGGGGGAGCAGG - Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
928680838 2:33700632-33700654 TAGTGTTGGTGTAGGAGAGCAGG - Intergenic
929126598 2:38528214-38528236 CGGCGGGGGAGGAGGGGAGCCGG - Intergenic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929594803 2:43169423-43169445 GAGTGTGGGAGGAGGGGCGCTGG + Intergenic
929723408 2:44396631-44396653 CACTGTTGGTGGAGGGGGGTAGG + Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931253812 2:60553976-60553998 CCGCGTGTGTGGGGGGGAGCAGG - Intergenic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
931430542 2:62205729-62205751 CAGTGTGAGAGGAGGAGCGCTGG + Intronic
931691656 2:64838982-64839004 GAGTGTGGGTGGGTGGGAGGGGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932737663 2:74265693-74265715 CAGTGTGGTTTGCTGGGAGCAGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935377266 2:102412030-102412052 CAGTGTGGGTGAGGAGGGGCTGG - Intergenic
935447928 2:103176177-103176199 AAGGGTGTGTGCAGGGGAGCGGG - Intergenic
936444652 2:112586137-112586159 CAGTGTGGGGGGTGGGCAGTGGG + Intronic
936519006 2:113200187-113200209 GAGTGTGGGTGGATGGGTGAGGG - Intronic
936527040 2:113248446-113248468 CAGTGTGGGAGTCAGGGAGCAGG + Intronic
937087773 2:119182600-119182622 AAGTGTGTGTTGGGGGGAGCTGG - Intergenic
937230818 2:120397130-120397152 GAGTGTGGGTGTGGGGGAGGAGG + Intergenic
937306017 2:120871349-120871371 CAGTGAGGATGCACGGGAGCTGG + Intronic
937349878 2:121153988-121154010 CAGAGAGGGTGGAGGAGAGGCGG - Intergenic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
937951862 2:127394436-127394458 CAGTGTGGGAGGAAGGGACGAGG - Intergenic
937984531 2:127632614-127632636 CAGTGGTGGGGCAGGGGAGCTGG - Intronic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938237376 2:129717308-129717330 CAGCGTGGCTGCAGGTGAGCTGG - Intergenic
938248899 2:129798710-129798732 CACTGTGGGTGAAGGCGTGCAGG - Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
938342385 2:130544249-130544271 CAATGTGGCTGCAAGGGAGCAGG + Intronic
938347447 2:130576460-130576482 CAATGTGGCTGCAAGGGAGCAGG - Intronic
938365403 2:130729478-130729500 CAGCCTGGGTGGCTGGGAGCTGG + Exonic
938418047 2:131120726-131120748 GAGTGTGGGAGGAAGGGAGGGGG + Intronic
938521904 2:132078942-132078964 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
939818100 2:146921437-146921459 CAGGGTGGGTGGATGGGAGGAGG + Intergenic
940451334 2:153842011-153842033 TACAGTGGGTGGTGGGGAGCAGG + Intergenic
941488279 2:166109859-166109881 CTATGTGGGTGGTGGGGAGGTGG + Intronic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943171954 2:184413135-184413157 CAGCATAGGTGGAGGGGAACTGG - Intergenic
944297268 2:198080522-198080544 CAGGTTGGGAGGAGGGGAGATGG - Intronic
945469511 2:210211466-210211488 CAGTGTTGGAGGAGGGGGCCTGG + Intronic
946051817 2:216869245-216869267 CATAGTGGGTGGAGGGGTGGAGG - Intergenic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
946411686 2:219518359-219518381 CATTCTGGGTGGAGGAGAGCTGG + Intronic
946434114 2:219640725-219640747 CGATGTGGGTGGGTGGGAGCAGG + Intronic
947499700 2:230663055-230663077 CAGCGTGGGTGGAAGTGGGCAGG - Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947909127 2:233790230-233790252 CAATGCAGGTGGAGGGGAGCAGG - Intronic
947977008 2:234375544-234375566 TAGTGTGGGGAGAGTGGAGCAGG + Intergenic
947990012 2:234479310-234479332 CAGTGGGCGTGGAAGGGACCAGG + Intergenic
948075164 2:235160311-235160333 CACTGTGGGATGAGGGGAGGGGG - Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
949036453 2:241817715-241817737 CAGGGTGGGGTCAGGGGAGCAGG - Intergenic
1168870967 20:1127928-1127950 AACTGTGGGTGTATGGGAGCAGG - Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171324224 20:24276633-24276655 CAGTGTGGGTGCAGGACAGCAGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172281705 20:33712403-33712425 TGGTGTGGGGGGAGGGGAGCAGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172628226 20:36360847-36360869 CAGGGTGGGTTTAGGGGAGAAGG + Intronic
1172697241 20:36831321-36831343 CAGTGTGGGTTGAGCTGGGCTGG + Intronic
1172828270 20:37808888-37808910 CACAGTGGGTGGTGGGGAGGAGG - Intronic
1173174450 20:40753856-40753878 GAGTGTGGGTGGCGGGAGGCGGG + Intergenic
1173492306 20:43492963-43492985 TAGTGAGGGTGGAGAGGGGCGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173881578 20:46417076-46417098 CAGGGTGGATGGGAGGGAGCTGG - Intronic
1173896839 20:46557578-46557600 CAATGTGGGAGGAAGGGAGAAGG - Intergenic
1173974212 20:47174961-47174983 CACGGAGGGAGGAGGGGAGCAGG + Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174081843 20:47975522-47975544 CAGCGTGGCAGGAAGGGAGCTGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174418724 20:50385409-50385431 GAGGGTGGGGGGAGGGGGGCGGG - Intergenic
1174468826 20:50739867-50739889 AAGGGTGGGGGGAGGGGAGAAGG + Intronic
1174969214 20:55255119-55255141 CAGTGAGGGTCCGGGGGAGCTGG - Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175691180 20:61067104-61067126 CTGGGTGGGTGGGGAGGAGCAGG + Intergenic
1175762457 20:61570933-61570955 CTGTGTGGGTGCAGGGCTGCAGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176030830 20:63010416-63010438 GGGTGGGGGAGGAGGGGAGCCGG - Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1176092830 20:63326535-63326557 CAGTGCTGGAGGAGGGGTGCAGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176242371 20:64081043-64081065 CAGAGTGAGTTGTGGGGAGCAGG + Intronic
1176364916 21:6026913-6026935 CAGCGTGGTTGGAGGAGACCTGG - Intergenic
1176774775 21:13122121-13122143 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1177955583 21:27594494-27594516 CAGTCTGGGAGGAGGAGAACTGG - Intergenic
1178317180 21:31576412-31576434 TAGTTTGGGAGGAGGGGAGGAGG + Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179362720 21:40727683-40727705 GAGTGTGTGTGTAGGGGACCAGG - Intronic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179758602 21:43511632-43511654 CAGCGTGGTTGGAGGAGACCTGG + Intergenic
1179839111 21:44058789-44058811 CAGTGAGGGGCGAGGGGAGCAGG + Intronic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1180558341 22:16595486-16595508 CATGGTGGGTGCAGGGGGGCTGG + Intergenic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1180723324 22:17925741-17925763 CACTGTGGAAGGAGGGGTGCCGG - Intronic
1180790379 22:18572501-18572523 CAGTTTGGGTTGAGCGGAGGTGG - Intergenic
1181020722 22:20100805-20100827 CAGTGTGGGAGGATCGGAGTAGG - Intronic
1181038606 22:20181627-20181649 CAGTGGGGGTGCAGGGGCCCTGG - Intergenic
1181231359 22:21422814-21422836 CAGTTTGGGTTGAGCGGAGGTGG + Intronic
1181247292 22:21512054-21512076 CAGTTTGGGTTGAGCGGAGGTGG - Intergenic
1181306515 22:21920226-21920248 CGCTGTGGGTGCAGGTGAGCCGG - Exonic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181680971 22:24495551-24495573 GAGTGTGGGTCTGGGGGAGCAGG + Intronic
1181713510 22:24706929-24706951 CAGGGTGAGTGGTGGGGGGCGGG - Intergenic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1181976578 22:26735166-26735188 CACTGTGGGTGGCCGGGAGCTGG + Intergenic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182249620 22:28989768-28989790 GAGGGTGGGTGGTGGGGAGGGGG - Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182624753 22:31637784-31637806 CAGTGCCGGGTGAGGGGAGCGGG - Intronic
1182686172 22:32122802-32122824 CATGGTGGGTGGAGGGGGGTGGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183750958 22:39720021-39720043 CACTGTGGTTGGAGGGGACTGGG + Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184073396 22:42161114-42161136 CAATGTGGGGGGAGGGGGGAGGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184208794 22:43023258-43023280 GAGTGTGGGTGAGAGGGAGCTGG - Intergenic
1184248911 22:43249300-43249322 CGGGCGGGGTGGAGGGGAGCTGG + Intronic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184407175 22:44306811-44306833 CGGCGTGTGTGGAGGGGACCTGG + Intronic
1184502110 22:44880530-44880552 TAGTTTGGGAGGAGGGGAGCAGG - Intergenic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185108028 22:48885350-48885372 GAGTGTGGGAGGACGGGAGGAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949301278 3:2586582-2586604 GAGTGTTGGTGGAGGGGTGCAGG - Intronic
950143678 3:10632889-10632911 CAGGGTGAGAGGAGGAGAGCAGG - Intronic
950152119 3:10695990-10696012 CAGAGTGGGTGGCTGGGGGCTGG - Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950553378 3:13680993-13681015 TAGTGTGGGTCATGGGGAGCTGG - Intergenic
950676033 3:14555070-14555092 GAGTGGGGGTGGGGAGGAGCTGG - Intergenic
950704872 3:14773414-14773436 AAGTGAGGGGGGAGGGGAGGGGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
952926040 3:38319788-38319810 CAGTGTGGGTGTGAAGGAGCTGG + Intergenic
953114327 3:39976891-39976913 CGTTGTGGGAGGAGGGGAGTGGG + Intronic
953203463 3:40798899-40798921 CAGAGTGGGAGTGGGGGAGCAGG - Intergenic
953358777 3:42276953-42276975 CAGAGTGGGTGGAGGGGCCCTGG + Intergenic
953797040 3:45993911-45993933 CAGGGTGGGTGGGGGTGAGGGGG + Intronic
954298628 3:49687531-49687553 AAGTGGGGGTGGAGAGGGGCAGG - Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954448609 3:50559795-50559817 AAGTGAGGGTGGAGGTGACCAGG - Intronic
954581113 3:51703404-51703426 AAATGTGGGGGGAGGGCAGCAGG + Intronic
954615259 3:51966254-51966276 CAGGGTGGGGGGCTGGGAGCAGG - Intronic
954645165 3:52126888-52126910 CAGTGTGGGTTGTTGGGAGGTGG - Intronic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
954778255 3:53039449-53039471 TAGGGTGGGAGGAGGGGAGTTGG + Intronic
954779059 3:53046005-53046027 GAGCGCGGGTGGAGGGGGGCGGG - Exonic
954947679 3:54440632-54440654 TGTTGTGGGCGGAGGGGAGCAGG - Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
955982454 3:64540655-64540677 CAGTGTGGGGGAAGCAGAGCTGG - Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
957040053 3:75329551-75329573 GAGGGAGGGTAGAGGGGAGCGGG + Intergenic
957079380 3:75623536-75623558 CACTGGGGGGGGGGGGGAGCGGG - Intergenic
959041213 3:101424706-101424728 CAATGTGGCTGATGGGGAGCAGG - Intronic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
959703029 3:109316192-109316214 GAGTGTGGGGGGAGGGGCGGGGG - Intronic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
959932934 3:112002615-112002637 CAGTGTGAATGGAAGGGACCCGG + Intronic
960302368 3:116019148-116019170 CATTGTGGGTGGGGGGGGGGGGG + Intronic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960834941 3:121896518-121896540 GAGGGTGGGTGGAGGAGAGTAGG - Intronic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961772963 3:129263612-129263634 CAGGTTGGGTGGAGGGGACTCGG + Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
961902203 3:130224054-130224076 CAGTGTGGGAGGAAAGGCGCCGG - Intergenic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
965694003 3:171387975-171387997 GAGTGTGGGGGGAGGGGACGGGG + Intronic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967055538 3:185825799-185825821 CAGAGAGCGTGGCGGGGAGCGGG - Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
967946800 3:194810523-194810545 AATTGTGGGTGGCGGGGAGGGGG + Intergenic
967975914 3:195034766-195034788 CACTGTGCGTGGAGGGATGCAGG + Intergenic
968085968 3:195874031-195874053 CTGTGTGCGTGCTGGGGAGCCGG - Intronic
968110890 3:196045616-196045638 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
968480615 4:831511-831533 CAGGGTGGGTGGACGGGGCCAGG - Intergenic
968516609 4:1018192-1018214 CAGGGAGGGTGGAGGTGGGCAGG - Intronic
968539152 4:1154251-1154273 CTGGGTGGGTGGGGGAGAGCTGG + Intergenic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968758428 4:2428526-2428548 CGCTGTGGGTGGAGGGGTGGGGG - Intronic
968815481 4:2819561-2819583 CAGTGGAGTTGGATGGGAGCAGG - Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969230734 4:5828464-5828486 GAGTGTGTCTGCAGGGGAGCGGG - Intronic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969860309 4:10030569-10030591 GTGTGTGGGTGTAGGGGGGCAGG + Intronic
969921085 4:10540434-10540456 GAGTGTGGGTGTGGGGGAGGGGG - Intronic
969976303 4:11105474-11105496 CGGGGTGGGAGGAGGGGAGAAGG + Intergenic
970075230 4:12210810-12210832 CAGAGTCGGGGCAGGGGAGCTGG + Intergenic
970446064 4:16124241-16124263 CAGTGAGGGTCGGGGGTAGCAGG + Intergenic
970511451 4:16785719-16785741 GGATGTGGGTCGAGGGGAGCAGG - Intronic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
971361489 4:25942431-25942453 CAGGGTAGGTGGAGGGGATGTGG - Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
975544657 4:75548533-75548555 AAGAGTGTGTGGAGGGGGGCTGG - Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978493591 4:109334763-109334785 CAATGTGTGTGGAGGGGTGGGGG - Intergenic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979333132 4:119439164-119439186 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
980153964 4:129081669-129081691 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981420046 4:144538980-144539002 CAATGTGAGTTGAGAGGAGCTGG - Intergenic
981566112 4:146103775-146103797 CGGGGTGGGTGGAGGTGAGGGGG + Intergenic
982149294 4:152434953-152434975 GTGTGTGGGGGGGGGGGAGCGGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982750568 4:159156632-159156654 CCATGTGGGTGGTTGGGAGCTGG - Intronic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984689827 4:182714158-182714180 CAGCCTGGATGGAGAGGAGCAGG + Exonic
984737588 4:183125024-183125046 CAGGGTGTTTGGAGGGGACCCGG + Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984867300 4:184292613-184292635 GAGTGTGTGTGGAGGGGCGGGGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985272664 4:188208936-188208958 CAGTGTGGGGTGGGGGGAGTGGG - Intergenic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
985504979 5:273683-273705 CGCTGTGGGTGGGGGGGTGCTGG + Intronic
985822716 5:2170806-2170828 CACTGTGGCTGCAGGTGAGCAGG + Intergenic
985827308 5:2202297-2202319 TAGTGTGGGGTGGGGGGAGCGGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
987425422 5:17767373-17767395 CACTCTGGATGGAGAGGAGCTGG + Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
989445399 5:41522705-41522727 GAGTGTGGGGGCAGGGGAGAAGG - Intergenic
989579184 5:43016312-43016334 CAGTGTGGTTGGAGGCGGGGTGG - Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
991493605 5:67207267-67207289 CTGTGTGGGTGCAGTGGAGCTGG + Intergenic
992848100 5:80774821-80774843 TAGTGGGGGTGGAGGGGATGAGG + Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995450076 5:112290857-112290879 CTGTGTGGGTGGTGCTGAGCAGG - Intronic
997015413 5:129928187-129928209 CAGGGTGGGGGGTGGGGAGAGGG - Intronic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997727118 5:136131334-136131356 CAGAGTGAGAGGAAGGGAGCGGG + Intergenic
997827794 5:137123188-137123210 CAGTGTTGGAGGAGAGGAGACGG + Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999056824 5:148587037-148587059 CAGTGGGGGTTCAGGGGAGCTGG - Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1000921974 5:167149159-167149181 TAGGGTGGGTGGAGGGGGGAGGG - Intergenic
1000960722 5:167597591-167597613 GAGTCAGGGTGGTGGGGAGCAGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1001814899 5:174660383-174660405 CAGGGAGGGTGGAGAGGAGGAGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002021157 5:176365373-176365395 CGGCGTGGGTGGTGGGGCGCTGG - Intergenic
1002130747 5:177080051-177080073 CAAAGTGGATGGAGGGGAACTGG - Intronic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002300664 5:178255772-178255794 CTGTGCAGGTGGTGGGGAGCGGG - Intronic
1002415878 5:179120824-179120846 CAGGGAAGGTGTAGGGGAGCCGG - Intronic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1003500162 6:6696559-6696581 CAGAGTGGGAGCTGGGGAGCTGG + Intergenic
1004201860 6:13555930-13555952 CAGAGTGGGGGGAGAGGAGCTGG + Intergenic
1004422931 6:15487803-15487825 CAGGGTGGGTGGGTGGGAGAAGG - Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004698768 6:18058942-18058964 CAGTGTGGGTGCAGGACAGTGGG + Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1004883293 6:20029157-20029179 CAGTGTGGGTGAAAGGGCCCAGG - Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1005496000 6:26388379-26388401 CAGTGTGGGTGGAATGGTCCTGG + Intronic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005559539 6:27024249-27024271 AAGAGTGGGTGGTGGGGGGCAGG + Intergenic
1005562042 6:27050313-27050335 CAGGGCGGTTGGAGGAGAGCCGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006083419 6:31580506-31580528 CAGGGTGGGTGCACGGGTGCGGG - Intronic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006902273 6:37510903-37510925 TAGGGAGGGTGGTGGGGAGCAGG + Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008766993 6:54929793-54929815 CAGTGTGTGTTTAGTGGAGCTGG + Intronic
1009314530 6:62201079-62201101 CTGTTTGGGGTGAGGGGAGCAGG + Intronic
1009498021 6:64374416-64374438 TGGGGTGGGTGCAGGGGAGCTGG + Intronic
1009680788 6:66889658-66889680 CATTTTGGGGGGAGGGGAGAGGG + Intergenic
1010770829 6:79828008-79828030 CTGTGCAGGTGTAGGGGAGCGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011337326 6:86275793-86275815 CAGTGTTGGTGCAGGGGTGGGGG + Intergenic
1012026970 6:94008304-94008326 CACTGTTGGTGGATGGGAGAGGG - Intergenic
1012100795 6:95083846-95083868 GAGTGCGGGGGGAGGGGAGGAGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013667636 6:112365004-112365026 AAGGGTAGGTGGAGGGGAGGGGG + Intergenic
1013874451 6:114806289-114806311 AGGTGTGGGAGGAGGGGAGGAGG - Intergenic
1014934751 6:127374410-127374432 CAGTTTGGGTGAAGGGGTGGAGG - Intergenic
1016607549 6:145949342-145949364 AAATGTGTGTGGAGGGGGGCAGG + Intronic
1016612025 6:146000474-146000496 GAGTGTGTGTGGAGGGGATGGGG + Intergenic
1016835478 6:148472558-148472580 CAGAGTGGGTGATGGGGAGTTGG - Intronic
1016990801 6:149926309-149926331 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1017007533 6:150038450-150038472 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1017039150 6:150293996-150294018 CATTGTGGGTGGAAGGGACCTGG + Intergenic
1017084528 6:150701600-150701622 CACTGTGGGGTGAGGGGAGGGGG - Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018039863 6:159912077-159912099 CAGTATGTGTGGCAGGGAGCAGG - Exonic
1018066614 6:160129026-160129048 CAGTGTGGAGGGACGGGGGCAGG + Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1019275020 7:171639-171661 CCGTGTGGGTGTCGGGGAGGAGG - Intergenic
1019321084 7:415524-415546 AATTGTGGGAGGAGGGGAGTGGG + Intergenic
1019564962 7:1674591-1674613 CAGTGAGGGGGGTGGGGAGAGGG + Intergenic
1019652850 7:2169947-2169969 CAGTCTGGGTGGAGGGGTTGCGG + Intronic
1019711765 7:2521176-2521198 CACTGTGGGTGGGTGGGAGCAGG + Intronic
1019778623 7:2926918-2926940 CAGTGTGGGTGGAGGAGGTTGGG + Intronic
1019979321 7:4609546-4609568 CAGGGTGGGGGCAGGGGGGCTGG + Intergenic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021183302 7:17533606-17533628 CAGAGTGGGAGGATGGGAGAAGG - Intergenic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023830540 7:44036653-44036675 CAAGGTGCGGGGAGGGGAGCGGG - Intergenic
1024070908 7:45784502-45784524 AGATGTGGGTGGAGGTGAGCTGG + Intergenic
1024982190 7:55166833-55166855 CAGTGTTGGTGGTGAGGAGGTGG + Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026931423 7:74224847-74224869 GAGTGTGGGTGGAGGGGCCATGG + Intronic
1026963894 7:74427096-74427118 CAGGGTTGGTGGCGGGGAGGTGG + Intergenic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027571717 7:79876483-79876505 CAATGTGGGGGGTGGGGTGCCGG + Intergenic
1028492787 7:91432362-91432384 CAGTGTGGGTGGAGGGGTCGAGG + Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029149597 7:98470635-98470657 CATTGCGGGTGCAGGGAAGCGGG - Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029740867 7:102490967-102490989 CAAGGTGCGGGGAGGGGAGCGGG - Intronic
1029758861 7:102590140-102590162 CAAGGTGCGGGGAGGGGAGCGGG - Exonic
1029996571 7:105013388-105013410 CAATGTGCGGGGAGGGGAGTGGG - Intergenic
1031699594 7:124906489-124906511 TAGGGTGGGGGGAGGGGAGAGGG + Intronic
1031941461 7:127793797-127793819 AGGTGAGGGTGGAGGGGAGGAGG - Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032098735 7:128955147-128955169 CGGCGTGGTGGGAGGGGAGCTGG - Exonic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032448107 7:132002038-132002060 CAGAGTGTGTGGTGTGGAGCAGG + Intergenic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1032706933 7:134428726-134428748 CAGGGTGGGAGGATGGGAGGGGG - Intergenic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1034283626 7:149870371-149870393 CAGTGTGGGTTGAGGGGCACTGG - Intergenic
1034618975 7:152442523-152442545 CATGGTGGGTGCAGGGGGGCTGG - Intergenic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1034960559 7:155361860-155361882 CAGTGAGGGAGGACGGGCGCTGG + Intronic
1035254791 7:157619373-157619395 AAGTGAGGGTGGTGGTGAGCGGG - Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035780505 8:2223831-2223853 CAGTTAGGGTCGAGGGAAGCTGG - Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1037324854 8:17678617-17678639 CTGTGTGGGTGATGGGGAGGAGG - Intronic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1037561207 8:20076117-20076139 CAGTGTGAGTGGAGTGGATGAGG - Intergenic
1037588541 8:20294683-20294705 CTTTGGGGGTGGCGGGGAGCAGG + Intronic
1038510147 8:28126191-28126213 CACTGAGGGTGGAGGGGTTCTGG + Intronic
1038692128 8:29773462-29773484 CGGGGTGGGTGGTGGGGGGCTGG - Intergenic
1039391013 8:37180768-37180790 CCGTCAAGGTGGAGGGGAGCAGG + Intergenic
1039864710 8:41490694-41490716 CAGCATGGGTGAAGGGGAGCGGG + Exonic
1039965216 8:42279053-42279075 GAGTAGAGGTGGAGGGGAGCAGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040644778 8:49385899-49385921 CAGTGTAGGAGGCGGGGAGGAGG - Intergenic
1040810578 8:51448280-51448302 AAGTGTGGGTGGTGGGGCGTGGG - Intronic
1041255436 8:55976477-55976499 CTGTGTGAGTGAAAGGGAGCGGG - Intronic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041785209 8:61624025-61624047 TAGTGAGGGGAGAGGGGAGCAGG + Intronic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042313063 8:67397599-67397621 CAATGTGGGTTGAAGGGAGAGGG - Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043512018 8:80959149-80959171 CACTGTTGGTGCAGGTGAGCAGG + Intergenic
1043516081 8:80996281-80996303 GAGTGTTGGTGGTGGGGAGGTGG + Intronic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044829189 8:96229383-96229405 CCGGGTGGGTGGAGGGAGGCTGG - Intronic
1045002969 8:97894189-97894211 CAGTGTGTGTGGTGGGGTGTGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045277322 8:100720669-100720691 CAGAGTGGGAGGAGGGGATGTGG - Intronic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1046291803 8:112172086-112172108 CAGTGTGGGAGGAAGACAGCCGG + Intergenic
1047492844 8:125388664-125388686 AGGGGTGGGGGGAGGGGAGCGGG - Intergenic
1047579096 8:126193045-126193067 CAGCTTGGGTGGCGGGGAGGGGG + Intergenic
1048040250 8:130720626-130720648 CAGTCTGGGCGGTGTGGAGCAGG - Intergenic
1048237311 8:132703631-132703653 CAGTGAGGGTGTTGGGGAGGGGG + Intronic
1048552331 8:135445050-135445072 CCGTGGGGGTGAAGGGGAGGGGG + Intergenic
1048987575 8:139743018-139743040 CAGAGTGGGCTGAGAGGAGCAGG + Intronic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1049310521 8:141931484-141931506 CAGTGGGGGTGGAGGTGTGTTGG + Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049656593 8:143801714-143801736 CAGTGACGGGGAAGGGGAGCTGG + Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049780579 8:144426884-144426906 GAGTGTGGCTGGAAGGGCGCAGG - Intronic
1049829996 8:144694285-144694307 CAGTGTAGGTGGCGGGGAGTGGG + Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1052451259 9:28634444-28634466 AAGTGTGGGGGGAGGGGAGTTGG - Intronic
1052935513 9:34089689-34089711 TGGGGCGGGTGGAGGGGAGCAGG - Intronic
1053151266 9:35744722-35744744 CAATGTGAGTGGAAGGGGGCAGG + Intronic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1055701920 9:78954144-78954166 CAGTGTGGTTAGGAGGGAGCAGG - Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1056595717 9:88006579-88006601 CAGTGTGGCTGTGGGGGCGCTGG - Intergenic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057319060 9:93995395-93995417 CAGTGTGTGTGGGGGTGGGCAGG - Intergenic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1057944905 9:99317534-99317556 CAGTGTGGGTGGATTGCAGGAGG + Intergenic
1058012584 9:99994497-99994519 TGGTGTGGGGTGAGGGGAGCGGG + Intronic
1058638882 9:107064027-107064049 AAGTGGGGGTGGAGGGGTGGTGG - Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1058972378 9:110095492-110095514 CTGAGTGGCTGAAGGGGAGCTGG - Intronic
1059394652 9:114026850-114026872 CAGTGTTGGTGGAGTCGAGGGGG + Intronic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061070128 9:128304534-128304556 CAGTGTGGGAAGAGAGGAACTGG + Intergenic
1061085213 9:128394093-128394115 AAGGGTGGGGGGAGGGGAGCAGG + Intergenic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061438382 9:130580972-130580994 CAGAGTGGTGGAAGGGGAGCTGG - Intronic
1061624414 9:131833310-131833332 CAGTGTGGGTTGCGTGGGGCTGG - Intergenic
1061704361 9:132441520-132441542 ATGTGTGGTTGGCGGGGAGCGGG - Intronic
1061726274 9:132583561-132583583 CAGTGCTGGTGGACAGGAGCAGG + Intronic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062315087 9:135963164-135963186 CAGTGTGGGTGGCAGAGTGCAGG + Intergenic
1062404497 9:136388713-136388735 GAGTCTGGGAGGAGGAGAGCTGG - Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1203785640 EBV:126073-126095 CAGTTGGGGAGGAGGGGAACTGG - Intergenic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186146870 X:6633487-6633509 TAGGATGGGGGGAGGGGAGCGGG - Intergenic
1186621303 X:11243224-11243246 GTGAGTAGGTGGAGGGGAGCAGG - Intronic
1186677995 X:11840885-11840907 TAGGGTGGGGGGAGGGGGGCGGG - Intergenic
1187024210 X:15417057-15417079 TACTGGGGGTGGAGGGGGGCGGG - Intronic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187820715 X:23285081-23285103 CAGTTTGGGTAAAGTGGAGCAGG + Intergenic
1188268025 X:28102635-28102657 TAGTGTGGGAGGCGGGGAGAGGG - Intergenic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189249303 X:39587636-39587658 CAGTGGGGGAGCAAGGGAGCTGG + Intergenic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190817135 X:53938710-53938732 CAGAATGGGTGGAGGTGGGCAGG + Exonic
1190884625 X:54520713-54520735 CTGTGGGGGTGCAGGGGAACTGG + Intergenic
1191072993 X:56421633-56421655 GAGAGTGGGTGCAGGGGAGTGGG - Intergenic
1191101608 X:56735566-56735588 CCGGGTGGGTGGAGGGAGGCTGG - Intergenic
1191747758 X:64508504-64508526 CAAAGTGGGGGGAGGGGAGAGGG + Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192260640 X:69504367-69504389 AAGTGTGTTTGGCGGGGAGCAGG - Intergenic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192903140 X:75521854-75521876 CACTGTGGGAGGTGGGGAGTGGG + Intronic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194421150 X:93673923-93673945 CAGGGTGGGCGGATGGGAGAAGG - Intergenic
1194518343 X:94887654-94887676 GTGTGTGGGTGCTGGGGAGCAGG + Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195906356 X:109848511-109848533 TGGAGGGGGTGGAGGGGAGCAGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196859315 X:120012678-120012700 CAGTGGGGGTGTGGGGGGGCAGG - Intergenic
1197416440 X:126179560-126179582 TGGGGTGGGGGGAGGGGAGCGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199099758 X:143785193-143785215 CAGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199194804 X:145015903-145015925 AAGTCGGGGCGGAGGGGAGCGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199526067 X:148793248-148793270 CAGGGTGGGTGGGGGAGGGCAGG + Intronic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199786597 X:151111942-151111964 CAGTGTGGGGGAATGGGTGCTGG + Intergenic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200154121 X:153966298-153966320 CAGAGTGGGTGCTGGAGAGCGGG - Intronic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic