ID: 1185295618

View in Genome Browser
Species Human (GRCh38)
Location 22:50052294-50052316
Sequence CAGTTTGACCACAGCTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185295618_1185295621 1 Left 1185295618 22:50052294-50052316 CCTGCTTAGCTGTGGTCAAACTG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1185295621 22:50052318-50052340 GTAACTTTAGAAAAATGGATGGG 0: 1
1: 1
2: 2
3: 30
4: 303
1185295618_1185295620 0 Left 1185295618 22:50052294-50052316 CCTGCTTAGCTGTGGTCAAACTG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1185295620 22:50052317-50052339 AGTAACTTTAGAAAAATGGATGG 0: 1
1: 0
2: 3
3: 38
4: 412
1185295618_1185295622 20 Left 1185295618 22:50052294-50052316 CCTGCTTAGCTGTGGTCAAACTG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1185295622 22:50052337-50052359 TGGGCAGAATACAATTCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 125
1185295618_1185295619 -4 Left 1185295618 22:50052294-50052316 CCTGCTTAGCTGTGGTCAAACTG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1185295619 22:50052313-50052335 ACTGAGTAACTTTAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185295618 Original CRISPR CAGTTTGACCACAGCTAAGC AGG (reversed) Intronic
902238677 1:15074073-15074095 CTGTGTGACCACAGCCAAGCTGG + Intronic
902445719 1:16462649-16462671 CAGTCTGGGCACAGCTTAGCTGG - Intergenic
902883343 1:19387356-19387378 CTCTGTGGCCACAGCTAAGCAGG - Intronic
907987225 1:59544025-59544047 CAGTTTGCCCCAAGATAAGCTGG + Intronic
916015313 1:160744158-160744180 GAGTTTTACCATATCTAAGCAGG - Intronic
917748297 1:178031946-178031968 CAGTTTTACCTCAGTAAAGCTGG + Intergenic
918346392 1:183610811-183610833 GACTTTGAGCACAGCTAAGCTGG - Intergenic
919986258 1:202677638-202677660 CAGTTTGAGCAGGGCTCAGCTGG - Intronic
919990082 1:202703497-202703519 CTGTTTCTCCACAGCTGAGCAGG + Intronic
920172625 1:204081406-204081428 CGGTTTGACCAGCGCTAAGAGGG + Intronic
1065152720 10:22838646-22838668 CAACTTGACCACAGCTAGGAGGG + Intergenic
1068717670 10:60206116-60206138 CATTTTTACCTCAGCTAACCAGG - Intronic
1070580867 10:77718375-77718397 CAGATTGAACACAGCTAAGGAGG + Intergenic
1072295548 10:94006062-94006084 CAGTTAGAAAACAGCAAAGCTGG - Intronic
1072382521 10:94890061-94890083 CAGTTTGCTCACAGTTATGCAGG - Intergenic
1075283322 10:121160385-121160407 CAGTTTGGCCAGAGCTCAGCAGG - Intergenic
1076495923 10:130897943-130897965 CAGCTGGACCCCAGCTATGCTGG - Intergenic
1076529067 10:131132643-131132665 CACGTGGACCTCAGCTAAGCTGG - Intronic
1076849125 10:133084368-133084390 CAGTCTGAACACAGCCCAGCTGG - Intronic
1077327422 11:1969758-1969780 CAGGTTGTGGACAGCTAAGCTGG - Intronic
1077425932 11:2477463-2477485 CACTTTGTTCACAGCTAACCTGG - Intronic
1081889106 11:46525394-46525416 CACTTTGGCCATGGCTAAGCTGG - Intronic
1086079699 11:82890405-82890427 CAGTTTGACCATAGTCAAACTGG - Intronic
1088648602 11:111937743-111937765 CTGCCTGCCCACAGCTAAGCTGG + Intronic
1088931069 11:114351263-114351285 CAGTTTGTCCACAGTTCATCAGG + Intergenic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1202810404 11_KI270721v1_random:24938-24960 CAGGTTGTGGACAGCTAAGCTGG - Intergenic
1100124529 12:91407498-91407520 GAGTTTGAACACAGCTTAGCTGG - Intergenic
1101561457 12:105861585-105861607 CTGTGTGCCCACTGCTAAGCTGG + Intergenic
1102625307 12:114230733-114230755 AAGTCTGAACACAGCTTAGCTGG + Intergenic
1104882752 12:132084036-132084058 CAGTGTGACCAGCGCTCAGCAGG + Intergenic
1106010265 13:25813912-25813934 CAGTTTGAAGGCAGCTAGGCAGG - Intronic
1106584695 13:31046787-31046809 CAGCTTGGCCACAGATCAGCTGG - Intergenic
1108077773 13:46699491-46699513 CAGCTTGCCCACAGAAAAGCAGG - Intronic
1108726811 13:53191901-53191923 CTTTGTGACCACAACTAAGCTGG + Intergenic
1112335800 13:98514706-98514728 CAGTTTAACCAAAGCAAATCAGG - Intronic
1115881825 14:37927961-37927983 CAGTTTGAAGATAGGTAAGCTGG + Intronic
1118225194 14:63892305-63892327 CATTTTGACCACAGCTCAGAAGG + Intronic
1118357397 14:65026205-65026227 CTGTTTCTCCACAGCTCAGCAGG - Intronic
1119499281 14:75109709-75109731 CACTGTGACCACAGCAAAGTGGG + Exonic
1119864802 14:77964684-77964706 GAGTTTGAGCACAGCTTAGTTGG + Intergenic
1121936213 14:98021379-98021401 AAGTTTGGGCACAGCTTAGCTGG + Intergenic
1127475534 15:59328941-59328963 AACTTTGCCCACAGCTAATCAGG + Intronic
1130722144 15:86398967-86398989 AAGTCTGGCAACAGCTAAGCTGG - Intronic
1131356971 15:91753693-91753715 GAGTTTGACAACAGGTAAACTGG - Intergenic
1139010728 16:62630048-62630070 CAGTTTAAGCACTGCTAAGAGGG - Intergenic
1140136392 16:72209739-72209761 CAGGTTGACCACACACAAGCTGG + Intergenic
1142110556 16:88328869-88328891 CAGTTTGGCCACAGCAGAGGAGG + Intergenic
1143282639 17:5766275-5766297 AAGTCTGACCACATCTCAGCCGG + Intergenic
1148058284 17:44815302-44815324 CAGTTGGACCCCAGCTATTCAGG - Intronic
1151638342 17:75369087-75369109 AAGTTTGAACCCAGATAAGCTGG + Intronic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1158711185 18:59839516-59839538 CACTTAAACCACAACTAAGCAGG + Intergenic
1161209652 19:3059723-3059745 CTGTGTGACCTCTGCTAAGCCGG - Intronic
1162781564 19:13009631-13009653 CAGTTTGAACACCCTTAAGCGGG - Intronic
1163603947 19:18264236-18264258 CACAGTGACCACAGATAAGCAGG + Intronic
1165210319 19:34230702-34230724 CAGTTTTTCCACAGATGAGCAGG + Intergenic
1165740465 19:38202285-38202307 AACTTTGAACACTGCTAAGCAGG + Intronic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927226686 2:20772969-20772991 AAGTCTGGCCACAGCTTAGCTGG - Intronic
927434859 2:23058255-23058277 CACTTTGACAACAGGTGAGCGGG + Intergenic
930613911 2:53573699-53573721 CAGTTTGCCCAGGGCTGAGCAGG - Intronic
933807038 2:86006226-86006248 GAGTTTGGGCACAGCTAAACTGG - Intergenic
935582754 2:104772485-104772507 CCCTTTGTCCACAGCTAAGATGG - Intergenic
935712821 2:105914117-105914139 CAGTTTGAGCAGAGCTCATCAGG - Intergenic
939159474 2:138569353-138569375 CATTTTGACCAAGGCTATGCAGG + Exonic
940584371 2:155626487-155626509 AAGTTTGACCCCAGCAAAGCTGG + Intergenic
942183096 2:173399184-173399206 TAATTTGACCAAAGCAAAGCAGG - Intergenic
943358531 2:186890289-186890311 CTGTTTGGCCACAACTAAGTGGG + Intergenic
944935683 2:204564942-204564964 CAGTCTGCACACAGCTTAGCTGG + Intronic
948403341 2:237700329-237700351 CAGTTTGTTCACAGACAAGCAGG - Intronic
1169807358 20:9573401-9573423 CAATTTCACCAGAGCTACGCTGG + Intronic
1170253103 20:14308133-14308155 CAGCTTGCCCAGAGCTAAACTGG + Intronic
1172781052 20:37437291-37437313 CTGTTTGGCCACAGATGAGCTGG + Intergenic
1179117436 21:38507047-38507069 CAGTTGCACCCCAGCGAAGCTGG - Intronic
1181555661 22:23670434-23670456 CAGTTTCCCCACATGTAAGCAGG - Intergenic
1182431692 22:30302589-30302611 CAGTATGGCCACAGCTGAGATGG + Intronic
1185295618 22:50052294-50052316 CAGTTTGACCACAGCTAAGCAGG - Intronic
949774212 3:7613275-7613297 CAGTTTGAGAACAGCTATGGAGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951809055 3:26679404-26679426 GAGTGTGACTGCAGCTAAGCAGG - Intronic
952126190 3:30303795-30303817 CATTTTGCCCACAGCTAAGATGG + Intergenic
956228926 3:66990862-66990884 CAGATTAATCACAGTTAAGCTGG - Intergenic
957474435 3:80705391-80705413 CTTTTTAACCACAGCTAAGGTGG + Intergenic
958153306 3:89719917-89719939 AAGTTTGACAACAGCTAGACTGG - Intergenic
959135946 3:102420499-102420521 AAATTTGAACACAGATAAGCTGG + Intronic
960092143 3:113651912-113651934 ATGTCTGAACACAGCTAAGCAGG + Exonic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
964394458 3:156231138-156231160 CATTTTGACCACAGTTGAGCTGG + Intronic
968808480 4:2789586-2789608 CAGTGTGGCCAATGCTAAGCGGG + Intergenic
972010767 4:34178490-34178512 CAGTTTGAGGAGAACTAAGCTGG - Intergenic
974975252 4:68883593-68883615 CATTTTGACCAATGCTATGCAGG - Intergenic
974993704 4:69126729-69126751 CATTTTGACCAATGCTATGCAGG + Intronic
979277150 4:118827204-118827226 CAGTCTGACCCCAGCCAACCTGG - Intronic
981964460 4:150583313-150583335 CAGTTTGAGCACTGCGCAGCCGG - Exonic
983102687 4:163644816-163644838 CAGTGGGACCAAAGTTAAGCAGG - Intronic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
998062079 5:139126778-139126800 GAGGTGAACCACAGCTAAGCTGG + Intronic
998796113 5:145820879-145820901 CAGTTAGAAGACAGCCAAGCGGG + Intronic
1000190809 5:158908892-158908914 CAGCTTGACCACAGCCCGGCTGG - Intronic
1007987775 6:46224474-46224496 CAGTTTGACCAAAACAAAGAAGG - Intronic
1010264692 6:73852948-73852970 CTATTTTACTACAGCTAAGCTGG + Intergenic
1011459339 6:87587313-87587335 CAGTTTGAGCATCCCTAAGCTGG - Intronic
1012007607 6:93734152-93734174 AAGTTTGACCACACCTTAACTGG + Intergenic
1012837763 6:104291962-104291984 CAGTATGACCTCATCTTAGCTGG + Intergenic
1018420138 6:163633987-163634009 CAGACTGATCACAGCTACGCAGG - Intergenic
1018494852 6:164338521-164338543 CAGTTATCCCACAGCTAAGAGGG + Intergenic
1020465151 7:8470087-8470109 CAATTTGACCATACCTGAGCTGG - Intronic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022077058 7:26982149-26982171 CCCTTTGTCCACAGCTAAGATGG + Intronic
1022602514 7:31775291-31775313 CAATTTGAACACAGAAAAGCTGG + Intronic
1022863962 7:34398176-34398198 CAGTGTGACTACTGCAAAGCAGG + Intergenic
1026831483 7:73612887-73612909 CAGGGTGCCCACAGCTTAGCGGG + Intronic
1032580651 7:133100152-133100174 CAATTTGAGCAGAGCTCAGCAGG - Intergenic
1044338442 8:91018052-91018074 CACTTTGACCTCTGCTGAGCAGG + Intronic
1055797947 9:79996534-79996556 TAGTATGACCTCACCTAAGCTGG - Intergenic
1056563244 9:87751131-87751153 CACTTTGCCCACAGCTCAGTGGG - Intergenic
1057119775 9:92560645-92560667 CAGTTTGAGGACAGCCAAACAGG - Intronic
1057931540 9:99197792-99197814 CTGTTTGGTCACATCTAAGCTGG + Intergenic
1061588027 9:131580846-131580868 GAGTTTGAGAACAGCTAGGCTGG + Intronic
1061759785 9:132842672-132842694 GAGTCTGAGCACAGCTCAGCTGG + Intronic
1190078555 X:47337114-47337136 CAGTTTGTCCACAGCCAATATGG + Intergenic
1191626520 X:63276525-63276547 CAGTTGGACTGCAGATAAGCAGG - Intergenic
1193652707 X:84157810-84157832 TAGTTTCACCAAACCTAAGCAGG + Intronic
1196991542 X:121334697-121334719 CAGTTTGAACACCTCTAAGATGG - Intergenic
1198260217 X:134959300-134959322 CACTTTGTTCACAGCTAAGATGG + Intergenic
1199773253 X:150988512-150988534 CCCTTTGTCCACAGCTAAGATGG - Exonic