ID: 1185296163

View in Genome Browser
Species Human (GRCh38)
Location 22:50056383-50056405
Sequence CACCCACTGCGGGTGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185296156_1185296163 -4 Left 1185296156 22:50056364-50056386 CCTGAAATGGCAGCGAGGACACC No data
Right 1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1185296151_1185296163 11 Left 1185296151 22:50056349-50056371 CCACACACCCGAGTGCCTGAAAT 0: 1
1: 0
2: 1
3: 3
4: 94
Right 1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1185296154_1185296163 3 Left 1185296154 22:50056357-50056379 CCGAGTGCCTGAAATGGCAGCGA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1185296153_1185296163 4 Left 1185296153 22:50056356-50056378 CCCGAGTGCCTGAAATGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185296163 Original CRISPR CACCCACTGCGGGTGGGGAC GGG Intronic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900325078 1:2104651-2104673 AAGCCAGTGTGGGTGGGGACTGG + Intronic
900366250 1:2313060-2313082 GCCCCGCTGCGGGTGAGGACCGG + Intergenic
901060740 1:6470879-6470901 CGCCCACTGCGGTGGGGGAGTGG + Exonic
901640881 1:10692452-10692474 CACCGACTGGAGGTGGGGGCAGG + Intronic
902015173 1:13301553-13301575 CACCCCCAGCTGGTGGGGAATGG + Intergenic
902711457 1:18242873-18242895 CACACTCTGCTGGGGGGGACAGG + Intronic
904114069 1:28148907-28148929 CACCCACTGAGGGTGGGCAAAGG - Exonic
904276856 1:29390570-29390592 CAGCCAGTGCAGGAGGGGACTGG + Intergenic
904285617 1:29451671-29451693 CCCCCACTGGGGGTGGGGAGGGG - Intergenic
904419806 1:30384354-30384376 CCCCCACTGGGGGTGGGGAGGGG + Intergenic
904610103 1:31721156-31721178 CACTCACTGGGGGTGGGGTGGGG - Intergenic
905410534 1:37765226-37765248 CACCCTCTGCTGGCGGGGATTGG - Intergenic
905888172 1:41502841-41502863 CACCCTCTGAGGCTGGGGTCAGG + Intergenic
906950774 1:50333235-50333257 AACCCAGTGCGTGTGGGGTCCGG - Intergenic
909160216 1:72137576-72137598 CACAGACTGGGGGTGGGGGCTGG + Intronic
912490510 1:110060257-110060279 CGCCCCCTGCTGGTGGGGAGGGG + Exonic
913453342 1:119007513-119007535 CGCCCACTGGGCGTGGGGACTGG + Intergenic
915463222 1:156081813-156081835 CCCCCACGGCGGGCGAGGACGGG - Exonic
916880412 1:169015177-169015199 CAGCAAGTGCTGGTGGGGACAGG - Intergenic
919896024 1:202010348-202010370 CACCCTCTGGGGTTGGGCACGGG - Exonic
920177080 1:204108669-204108691 CACCCACTGCGGGCGCAGGCCGG - Intronic
921584271 1:216929466-216929488 CACCCAGTGCGTGTGTGGAGGGG + Intronic
922411392 1:225379118-225379140 CACACTCCGCGGGTGGTGACAGG - Intronic
923195780 1:231665941-231665963 CACCCTCTGAGGGTGTGGAAGGG + Intronic
1062949300 10:1485530-1485552 CACCCACTGCAAGTGGGCAGCGG - Intronic
1063920921 10:10932032-10932054 CACACACTGTGGGAGGGGCCTGG - Intergenic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1066562027 10:36679802-36679824 CAGGAACTACGGGTGGGGACAGG + Intergenic
1067112188 10:43408642-43408664 GTCCCCCTGGGGGTGGGGACGGG - Intronic
1067322574 10:45235994-45236016 CACGAACTGCGAGTGGGCACTGG - Intergenic
1067529448 10:47059836-47059858 CCCCCACTGCTGGTGGCGATGGG - Intergenic
1067662951 10:48250165-48250187 CACGCACTGCAGGTGGGGGTTGG - Intronic
1067750620 10:48968922-48968944 CACCCACTGCAGCTGGGCCCTGG - Intronic
1067836301 10:49643860-49643882 CACTCACTGAGGGTGGGGCCTGG - Intronic
1068887871 10:62116050-62116072 CACCCACTGTGTCAGGGGACAGG - Intergenic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1070402822 10:76068412-76068434 CACAGACTGGGGGTGGGGATGGG + Intronic
1072279287 10:93851374-93851396 GACCCTCTGTGGGTGGGAACTGG - Intergenic
1075067811 10:119301434-119301456 CACCCACTATGTGTGGAGACAGG - Intronic
1075445000 10:122506896-122506918 GTCCCTCTGCGGGTGGGGATTGG + Intronic
1076736331 10:132460835-132460857 CACCCAGGCCAGGTGGGGACAGG - Intergenic
1076738217 10:132468128-132468150 CTCCCAGGGCGGGAGGGGACGGG + Intergenic
1076829450 10:132986641-132986663 CTTCCCCTGAGGGTGGGGACAGG + Intergenic
1077094103 11:792111-792133 GTCCCACGGCGGGTGGGGCCTGG - Intronic
1077174390 11:1182022-1182044 CAGGGACCGCGGGTGGGGACAGG + Intronic
1078512143 11:11992968-11992990 CACCCACTGTAGGTGAGGGCTGG + Intronic
1080048296 11:27832785-27832807 CATCCACTGCTGATGGGGAGTGG + Intergenic
1080600911 11:33819962-33819984 CACAGACTGCGGGTGTGGAGAGG - Intergenic
1083184248 11:61008207-61008229 GACCCAGAGCGGGCGGGGACAGG - Intronic
1083292117 11:61696134-61696156 CACCCTCTGCGGGAGGGGCTGGG + Intronic
1084768275 11:71326283-71326305 CAGCCCCTGCGGGTGGCCACAGG + Intergenic
1084891406 11:72238762-72238784 CCCCCGCTGGGGGTGGGGGCGGG + Exonic
1085009679 11:73129729-73129751 CATGGACTGCGGGTGGGGTCAGG - Intronic
1085052765 11:73388316-73388338 CACCTACTGCGTGCGGGCACTGG - Intronic
1085253776 11:75160491-75160513 AACCCACTGCGGCTGGTGAGAGG + Intronic
1089460209 11:118648585-118648607 CATCCACTGATGGTGGGGACTGG - Intronic
1089493910 11:118899174-118899196 CCCCCACTGGGGGTGGGGGCGGG - Exonic
1090189039 11:124756494-124756516 CTCCCAGTGCAGGTGGGGAGGGG + Intronic
1090193186 11:124791445-124791467 CTCCCAGTGCAGGTGGGGAGGGG - Intronic
1090396812 11:126424553-126424575 CACACACCGCGGGTGGGGACGGG - Exonic
1092140595 12:6180708-6180730 CACCCACTGCGGGGCAGGCCTGG + Intergenic
1095954438 12:47798292-47798314 CTCCTACTGAGGATGGGGACAGG - Intronic
1096418623 12:51436156-51436178 CTCCCAGTGCGGCTGAGGACTGG - Intronic
1098973279 12:76878140-76878162 CACCCCCTGGGGGCGGGGGCGGG - Intronic
1099989422 12:89708106-89708128 GACGCACTGCGGGAGGGGAGCGG - Intronic
1100602374 12:96122857-96122879 CACCAACAGCAGGTGGGCACTGG + Intergenic
1104109371 12:125690458-125690480 CACCTATTGGGGGTGGGGAAAGG - Intergenic
1104781695 12:131425576-131425598 CACCCAGTGAGGGTAGAGACAGG + Intergenic
1106106266 13:26736032-26736054 CACTCACTGCGGGTGTGAGCTGG + Intergenic
1108342909 13:49515260-49515282 CACACACCCAGGGTGGGGACAGG + Intronic
1108592959 13:51926680-51926702 CACGCACAGTGGGTGGGGACAGG + Intergenic
1114671881 14:24415847-24415869 AAACCACTGGGAGTGGGGACTGG - Exonic
1119520310 14:75279941-75279963 CAGCCACTGCAGGTCCGGACTGG - Exonic
1122263952 14:100538188-100538210 CACCCAGCGAGGGGGGGGACGGG - Exonic
1122418450 14:101561227-101561249 CAGCCGCTGCCGCTGGGGACCGG - Intergenic
1122424777 14:101599475-101599497 CACCCAGTGAGGGAGGGGTCTGG + Intergenic
1122924262 14:104892481-104892503 CTCACACTGAGGGTGGGGGCTGG - Intronic
1202903942 14_GL000194v1_random:57988-58010 CCAGCACTGCGGGTGTGGACAGG - Intergenic
1131086022 15:89576062-89576084 CTCCCTCTGCGAGTGCGGACAGG - Exonic
1132038081 15:98503038-98503060 CACTGACTGAGGGTGGAGACTGG + Intronic
1132903915 16:2272462-2272484 CAGCCACAGTGGGTGGGGTCTGG + Intergenic
1133029790 16:3004860-3004882 CACCCGCCGCGGGAGGGGCCAGG - Intergenic
1133305087 16:4803571-4803593 AACACACTGGGGGTGGGGGCGGG - Exonic
1133535805 16:6701314-6701336 CACCCCCTGCAGCTGGGTACGGG + Intronic
1135064281 16:19296184-19296206 CAGCCGCTGGGGTTGGGGACAGG + Intronic
1135194309 16:20381836-20381858 CACCCACTGCAGGTGGGCATAGG - Intronic
1136418327 16:30116866-30116888 GCCCCACTGCTGCTGGGGACTGG + Intronic
1138230849 16:55335028-55335050 GTCCCACTGAGGGTGGGGAGAGG - Intergenic
1139493792 16:67301576-67301598 TTCCCACTGAGGGTGGGGAGTGG - Intronic
1140650026 16:77077700-77077722 AACCCATTGTGGGTGGGGATGGG - Intergenic
1141820172 16:86440306-86440328 CTCCTACTGGGGGTGGGGGCTGG + Intergenic
1144424223 17:15126202-15126224 CACCCAATGCTGGTGAGGACAGG + Intergenic
1144492181 17:15722667-15722689 CTTGCACTGTGGGTGGGGACAGG + Intergenic
1144908292 17:18656533-18656555 CTTGCACTGTGGGTGGGGACAGG - Intronic
1147439075 17:40436487-40436509 CTCCTACTGCTGGTGGGGAAAGG + Intergenic
1148388253 17:47252284-47252306 CAACCACTTGGGGTGGGCACTGG - Intergenic
1148442143 17:47716939-47716961 GACCCACTGCGGGTGGGGAGTGG + Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148867655 17:50637235-50637257 CACCCAGTGTGGCTGGTGACTGG + Intronic
1149090289 17:52769863-52769885 CAGCCATTGCGGGTGGGAAGAGG + Intergenic
1149660668 17:58332606-58332628 CATCCCCTGCGGGCGGGGGCGGG - Intergenic
1149943738 17:60899098-60899120 CAGCCATGGTGGGTGGGGACAGG + Intronic
1149993133 17:61393799-61393821 CACCCCCTGCTGCTGGGGCCAGG - Intergenic
1150859959 17:68791001-68791023 CACCCACTGTGGGTTGAGTCAGG + Intergenic
1151758148 17:76086425-76086447 CACCCAGGGTGGGTGGGGGCAGG - Intronic
1152855343 17:82662494-82662516 CACCCACTGGGGCTGGGGTTGGG - Intronic
1158658189 18:59359471-59359493 CACCCTCCGGGGGTGGGGAAAGG + Exonic
1158721959 18:59933015-59933037 GCCCCACTGGGGATGGGGACTGG - Intergenic
1159821031 18:73143721-73143743 CAGGAACTGGGGGTGGGGACGGG - Intergenic
1160537172 18:79600825-79600847 GACCCCCTGCGGGTGGGGGAAGG - Intergenic
1160548329 18:79677103-79677125 CACATACTGCTGGTGGGAACAGG + Intergenic
1161264598 19:3358598-3358620 GAGCCGCTGCGGGTTGGGACCGG - Intergenic
1162827787 19:13264286-13264308 GACCCACTGGGGATGGGGATGGG - Intronic
1162968120 19:14165343-14165365 CACCTGGTGGGGGTGGGGACCGG - Intronic
1163667001 19:18607911-18607933 CGCCCGCATCGGGTGGGGACCGG - Intronic
1163720431 19:18895940-18895962 CACGGACTGCGGCTGGGGGCTGG - Exonic
1163824259 19:19514264-19514286 CACCCACGGCTGGTTGGGAAGGG + Exonic
1165096616 19:33413228-33413250 CACACACAGCATGTGGGGACCGG - Intronic
1165798381 19:38532577-38532599 CAAGCACTGCAGGTGGGGAGAGG - Intronic
1166374883 19:42322119-42322141 CAGCCACCGAGGGAGGGGACAGG + Intronic
1166784896 19:45361752-45361774 CACTCAGTGAGGGTGGGCACTGG + Intronic
1167037380 19:47002282-47002304 CAACCACTGCAGGCGGGCACGGG - Exonic
1167242266 19:48351413-48351435 AACCCACTGGGGATGGGGACGGG - Intronic
1167606158 19:50482053-50482075 CACCCACCCACGGTGGGGACCGG - Intronic
1167970379 19:53185620-53185642 CACCCACATTGGGTGTGGACAGG + Intronic
1168637011 19:58004127-58004149 CACTCACTGTGGGTGGGCAAAGG + Intronic
925132051 2:1501197-1501219 CACTCACTGCATGTGGAGACTGG + Intronic
927645662 2:24875351-24875373 CACCCACGGGGGGTGGGGTGGGG - Intronic
929650580 2:43676491-43676513 CGGCCACTGCGGGTGGGGTCCGG + Intronic
938116328 2:128605247-128605269 CACCTCCTGCGGGTGGGCAGAGG - Intergenic
940987376 2:160062656-160062678 CACCCACTGCGGCTTGGGGAAGG + Intergenic
944171681 2:196786379-196786401 CATCAACTGAGAGTGGGGACTGG - Intronic
947119321 2:226799483-226799505 CAGCCACTGCAGCTGGGGACCGG + Exonic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG + Intergenic
1172006693 20:31823016-31823038 CACCCATGGCGGGGCGGGACCGG - Intronic
1172166457 20:32902720-32902742 TATCCTCTGCGGGTGGGGCCTGG + Intronic
1173150406 20:40562158-40562180 CACTCTCTGGGGGTGGGGTCAGG + Intergenic
1173246287 20:41340100-41340122 CAGGCACTGCGGGAGGGGACAGG - Intergenic
1175478369 20:59293309-59293331 AAGCCACTGCGGGTGGGGGAAGG - Intergenic
1175949879 20:62577732-62577754 CACACACAGCAGGTGGGGGCGGG - Intergenic
1175992191 20:62795190-62795212 GAGTCACTGCGGATGGGGACCGG - Intergenic
1176064260 20:63186698-63186720 CAGCCACTAGGGGTGGTGACTGG + Intergenic
1178885021 21:36478537-36478559 CACTCACTGGAGTTGGGGACGGG - Intronic
1179144141 21:38752599-38752621 CACCTTCTGCGGCTGGGCACTGG + Intergenic
1179504015 21:41828128-41828150 CACCTGCTGCGGGCGGGGAGAGG - Intronic
1180934119 22:19613033-19613055 CACACACTGCAGGTGAGGAAAGG - Intergenic
1181038572 22:20181510-20181532 GTCCCACTGCAGCTGGGGACAGG - Intergenic
1181112026 22:20607831-20607853 CACCCACCGCGGGTGTGCAGCGG - Intergenic
1181624273 22:24112774-24112796 GACCCACTGCAGCTGGGGAAGGG - Intronic
1183635905 22:39062488-39062510 CACCCAGTGAAGGTGAGGACAGG + Intronic
1184532979 22:45068539-45068561 CACCCACAGCTGGAGGGCACTGG + Intergenic
1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG + Intronic
1185384719 22:50526471-50526493 CGCCCCCTGCGGGCGGGGACGGG + Exonic
950008214 3:9704732-9704754 CCACCACTGCAGGTGGGGGCGGG - Exonic
956407606 3:68944321-68944343 CATTCACTGGGGGTGGGGATGGG + Intergenic
959126938 3:102301060-102301082 CAGAAACTGAGGGTGGGGACTGG + Intronic
962260528 3:133900276-133900298 CATCCATTGCTGGTGGGGAGTGG - Intergenic
962275675 3:134011661-134011683 CACCCAGTGCTAGTGGGAACGGG - Intronic
964242823 3:154616374-154616396 CACCCACTGGGGTTGGCCACAGG - Intergenic
968429299 4:545876-545898 CCCCTGCTGGGGGTGGGGACGGG + Intergenic
968872985 4:3250863-3250885 CTCCCACTAGGGCTGGGGACTGG - Intronic
969470959 4:7389069-7389091 CACGCACTGCCCGTGGGGGCAGG - Intronic
969690514 4:8701624-8701646 CACCCCCTGCAGGTGTGGCCTGG + Intergenic
970441336 4:16083344-16083366 CATCCACTGGGGATGGGGGCGGG - Intronic
975004892 4:69271920-69271942 CACCAACTGCTGTTGGGAACTGG - Intergenic
975718357 4:77227278-77227300 CAGCCACTGTGGGAGGGGATAGG + Intronic
976503454 4:85818287-85818309 CACCCCCTGCAGGTGGGCAGGGG - Intronic
985657173 5:1138244-1138266 CACCCACTGCCGGCGGGGTGGGG + Intergenic
986247075 5:6018645-6018667 CAGCCACTGTGGGTGGGAATGGG + Intergenic
991512578 5:67396190-67396212 CAGCCACTGGGTGTGGGGATGGG + Intergenic
992603752 5:78433951-78433973 GACCCACTGCAGCTGGGGAAAGG - Intronic
997472103 5:134122845-134122867 CTCCTGCTGCAGGTGGGGACAGG + Intronic
997599195 5:135127770-135127792 CAACCACGCAGGGTGGGGACAGG - Intronic
997618156 5:135266914-135266936 CACCCACTCTGGCTGGGCACTGG + Intronic
998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG + Intergenic
1001925211 5:175631158-175631180 CACCCACTGCTGGAGGTGATGGG + Intergenic
1006780818 6:36631229-36631251 CCCACACTGCCAGTGGGGACAGG - Intergenic
1008219067 6:48833869-48833891 CCCGCACTGGGGGTGGGGATGGG + Intergenic
1008441378 6:51535526-51535548 CACCAGCTGCGGATGGGGAGTGG - Intergenic
1013195979 6:107845938-107845960 CTGTCACTGCAGGTGGGGACAGG - Intergenic
1016915140 6:149237738-149237760 CACCCACAGTGGGAGGGGACTGG - Intronic
1017642480 6:156507771-156507793 CACCCACTGCTCGTCGAGACTGG - Intergenic
1017810763 6:157981931-157981953 GGCCCACTGCGGGCGGGGGCCGG - Exonic
1018726363 6:166616057-166616079 CACCCACTGTGTGTGGGTGCAGG + Intronic
1019105472 6:169663955-169663977 CACCTGGTGTGGGTGGGGACGGG - Intronic
1020585813 7:10065143-10065165 AACTAACTGAGGGTGGGGACAGG + Intergenic
1021119167 7:16778516-16778538 CAACCACTGAGCGTGGGGAGAGG - Intronic
1023054705 7:36282449-36282471 CACTCCCTGCGGGAGGGGCCAGG - Intronic
1023823977 7:43996407-43996429 AACTCTCTGAGGGTGGGGACTGG + Intergenic
1024450962 7:49542549-49542571 CACCCACTGGGGCTGGGAAGGGG - Intergenic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1024948509 7:54834783-54834805 CACACACTGAGGGTGGGAGCAGG - Intergenic
1025150289 7:56541948-56541970 CACCACCTGAGGCTGGGGACTGG - Intergenic
1026891481 7:73985341-73985363 CTCCCTCTGCAGGTAGGGACAGG + Intergenic
1027914815 7:84303123-84303145 CACCCAGTGAGGGTGGGGATTGG - Intronic
1029256726 7:99274365-99274387 GACCCGCAGAGGGTGGGGACAGG + Intergenic
1030364106 7:108626719-108626741 GATCCACTCCAGGTGGGGACAGG + Intergenic
1033028525 7:137801726-137801748 CACCCACTGGGGGTGAGAGCTGG + Intronic
1034051107 7:147985272-147985294 CCCCCACTGGGGGTGGGGGGTGG + Intronic
1034300005 7:150007085-150007107 CCCTCACTGCTGGTGGGGAGGGG - Intergenic
1034806039 7:154090225-154090247 CCCTCACTGCTGGTGGGGAGGGG + Intronic
1034959511 7:155356283-155356305 CACTCACTGATTGTGGGGACTGG + Intergenic
1035126994 7:156616018-156616040 TGCCCACTCCGGGTGGGTACTGG + Intergenic
1035301213 7:157898504-157898526 CATCCTCTGCGGGTGGGAAACGG - Intronic
1035426869 7:158783928-158783950 AACCCACTGCAGCTGGGGAGAGG + Intronic
1037760004 8:21735541-21735563 CACCCACTGCTGGTGCTGAGTGG + Intronic
1040413904 8:47180979-47181001 CACCCCCTGCTGGAGGGGAGAGG - Intergenic
1045556409 8:103218796-103218818 CAGACACTGGGGGAGGGGACAGG - Intronic
1048495115 8:134928732-134928754 CACCCACTGCTGGCTGGGAAAGG + Intergenic
1048867716 8:138773007-138773029 CAGACACTGAGGCTGGGGACAGG + Intronic
1048883873 8:138892852-138892874 TGCCCATTGCGGGTGGGGGCTGG + Intronic
1049561520 8:143314125-143314147 CACACACTGCTGGTGGGGAGGGG + Intronic
1049734882 8:144199614-144199636 CATCCAGTGGGGGTGGTGACAGG - Intronic
1052691375 9:31820665-31820687 CAGGCACTGGGGGTGGGGAGAGG - Intergenic
1052771710 9:32696381-32696403 GACCCACTGCGGCTGGGCAAAGG + Intergenic
1053163513 9:35829361-35829383 CACCCCCCGGGGGTGGGGAGCGG + Intronic
1056544353 9:87601411-87601433 CACACCCTCTGGGTGGGGACAGG + Intronic
1060435186 9:123586749-123586771 CTCAAACTGGGGGTGGGGACAGG + Intronic
1060988748 9:127836290-127836312 CACCCACTCAGGGAGGGGGCTGG - Intronic
1061387284 9:130297879-130297901 CACCCACTTCCACTGGGGACAGG - Intronic
1062007153 9:134245296-134245318 CACACACAGTGGGTGGAGACAGG + Intergenic
1062048580 9:134435648-134435670 CCCCCACTGCAGGTGGAGCCAGG - Intronic
1062420092 9:136476549-136476571 CACCCACTGGGGGCTGGGGCCGG - Exonic
1062642202 9:137524882-137524904 CACCAACTGCTGGTGAAGACAGG - Intronic
1203746497 Un_GL000218v1:43183-43205 CCAGCACTGCGGGTGTGGACAGG - Intergenic
1203563611 Un_KI270744v1:76297-76319 CCAGCACTGCGGGTGTGGACAGG + Intergenic
1186867442 X:13734514-13734536 CTCCCACTGCAGGTAGGGAATGG - Exonic
1186990599 X:15063060-15063082 CACTCACAGCAGCTGGGGACTGG + Intergenic
1187974212 X:24688937-24688959 CACCAACTGAGGGTGGGGTGTGG - Intergenic
1194224910 X:91244677-91244699 CAGCCATTGTGGGTGGGGGCTGG + Intergenic
1198086870 X:133290276-133290298 CAACCTCTGCGGATGGGGCCTGG + Intergenic
1200561373 Y:4707987-4708009 CAGCCATTGTGGGTGGGGGCTGG + Intergenic
1201159827 Y:11158197-11158219 CCAGCACTGCGGGTGTGGACAGG - Intergenic
1201290835 Y:12420362-12420384 CACCCACTGCGCCTGGGCGCAGG - Intergenic