ID: 1185296879

View in Genome Browser
Species Human (GRCh38)
Location 22:50058804-50058826
Sequence AAGTTCCGCCGCAGGACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185296879_1185296889 -10 Left 1185296879 22:50058804-50058826 CCCCCCGTCCTGCGGCGGAACTT No data
Right 1185296889 22:50058817-50058839 GGCGGAACTTGGGAGGGCCTTGG No data
1185296879_1185296893 13 Left 1185296879 22:50058804-50058826 CCCCCCGTCCTGCGGCGGAACTT No data
Right 1185296893 22:50058840-50058862 TATCCGCAGAACCACTCGTGGGG No data
1185296879_1185296892 12 Left 1185296879 22:50058804-50058826 CCCCCCGTCCTGCGGCGGAACTT No data
Right 1185296892 22:50058839-50058861 GTATCCGCAGAACCACTCGTGGG No data
1185296879_1185296891 11 Left 1185296879 22:50058804-50058826 CCCCCCGTCCTGCGGCGGAACTT No data
Right 1185296891 22:50058838-50058860 GGTATCCGCAGAACCACTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185296879 Original CRISPR AAGTTCCGCCGCAGGACGGG GGG (reversed) Intergenic