ID: 1185297450

View in Genome Browser
Species Human (GRCh38)
Location 22:50061334-50061356
Sequence GTGTCGTAACAGCAGGAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185297450_1185297454 -10 Left 1185297450 22:50061334-50061356 CCATGCTCCTGCTGTTACGACAC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1185297454 22:50061347-50061369 GTTACGACACGGGAGCCACTCGG 0: 1
1: 0
2: 0
3: 1
4: 21
1185297450_1185297456 11 Left 1185297450 22:50061334-50061356 CCATGCTCCTGCTGTTACGACAC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1185297456 22:50061368-50061390 GGAGCTGACTGATCTCACTGAGG 0: 1
1: 0
2: 2
3: 15
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185297450 Original CRISPR GTGTCGTAACAGCAGGAGCA TGG (reversed) Exonic
901237590 1:7675822-7675844 GTGATGGAACTGCAGGAGCAGGG + Intronic
901826476 1:11865188-11865210 GTCTCTCAACAGCAGGGGCATGG + Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
906801303 1:48739523-48739545 GTGCCGTAACATCAAGAGGATGG + Intronic
917272321 1:173291188-173291210 ACGTGGTAAAAGCAGGAGCAAGG + Intergenic
918258033 1:182768013-182768035 GTGTCTTAACAGCAAAAACAAGG - Intergenic
918657600 1:187047465-187047487 TTGTGGTAACAGCAGGATAATGG + Intergenic
920067367 1:203278417-203278439 GTGTCCAAACAGCAGCAGGAAGG - Intergenic
1063472240 10:6297416-6297438 GTGGCCCAAGAGCAGGAGCAGGG + Intergenic
1067165955 10:43866816-43866838 ATATCCTAACAGGAGGAGCACGG - Intergenic
1067343114 10:45419863-45419885 GGGACGTAGCAGCAGGAGGAAGG + Intronic
1068733368 10:60385006-60385028 GTGTTGTAGCAGCAGCAGCAGGG - Intronic
1070214565 10:74363514-74363536 GTTCCCTAACAGCAGGAGGAGGG + Intronic
1079427292 11:20355922-20355944 GTCTATTAACAGCAGGAGAATGG - Intergenic
1080548560 11:33347685-33347707 GTGTAGTAGTAGCAGGAGCCAGG - Exonic
1084333177 11:68441563-68441585 GGGTTGCAGCAGCAGGAGCAGGG - Intronic
1085395371 11:76204565-76204587 GTGTCCTAGCAGAGGGAGCATGG - Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1096478435 12:51922770-51922792 GGGTCATTACAGCAGGAGCGGGG - Intronic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1115073808 14:29361043-29361065 GTGTTGTAACAGCTAGACCAGGG + Intergenic
1115520508 14:34228787-34228809 GAGTGGTTACACCAGGAGCAAGG + Intronic
1119694903 14:76705423-76705445 GTGCTGAGACAGCAGGAGCAGGG - Intergenic
1124596070 15:31092198-31092220 GAGTGGGAACAGCAGGGGCAAGG + Intronic
1125539309 15:40460598-40460620 GTGTCTCAACAGCCGGAGCATGG - Intronic
1129231954 15:74201934-74201956 GTGTCTTAACAGCAGGGTGAGGG + Intronic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1131075221 15:89491170-89491192 GTGGCCTGAGAGCAGGAGCAGGG + Intronic
1142221077 16:88855459-88855481 GTGTCCTGACAGCAGTAGCCGGG - Intronic
1142744691 17:1950002-1950024 GGGTCAGAACAGCAGGAGCCAGG + Intronic
1144945427 17:18967276-18967298 GTGCAGGAACGGCAGGAGCAAGG - Intronic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1150872012 17:68922766-68922788 GTATCATAATAGCAAGAGCATGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1153011709 18:545605-545627 GTGTCCTGAGAGCAGGAACATGG + Intergenic
1155182626 18:23361251-23361273 GTGTCTTAACTGGAGCAGCAGGG + Intronic
1162040511 19:7968381-7968403 GTGAGGTGACAGCAGCAGCATGG - Intronic
1164237562 19:23350448-23350470 GTGTCATTGTAGCAGGAGCATGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166693648 19:44839665-44839687 GGGTGGTGACAGCGGGAGCAGGG - Intergenic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
930058715 2:47271729-47271751 GTATCATAGCAACAGGAGCATGG + Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931697937 2:64885792-64885814 GTCTCGTACCACCAGGAACATGG - Intergenic
934682378 2:96294027-96294049 GGGTCATAGCAGCAGCAGCATGG - Intronic
939552909 2:143637500-143637522 GTCTCATAACAACAGGAGCTGGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1180987901 22:19916240-19916262 GTGTGGTAACACCAAGAGAACGG + Intronic
1181757612 22:25035667-25035689 CTGTAGTGACAGCAGCAGCAAGG + Intronic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
953874712 3:46660070-46660092 GTGTGGTCACAGCAGGAAGAGGG - Intergenic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956652082 3:71513500-71513522 GTGGGGTAAGAGAAGGAGCAGGG - Intronic
960574973 3:119220517-119220539 GTGTCGCCACATCAGGAGGAGGG + Intronic
963970619 3:151425681-151425703 TTGTGGTTACAGCAGGAGCATGG + Intronic
968624765 4:1622176-1622198 GTGCCGTTACAGCAGCAGCACGG + Intronic
968909748 4:3471599-3471621 GTGTGGGAACAGCATGAACACGG - Intronic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
970751966 4:19374628-19374650 ATGTCGTAACAAAAGGAGGAGGG - Intergenic
974651264 4:64756227-64756249 ATGTGGCAAGAGCAGGAGCAAGG - Intergenic
978841213 4:113215157-113215179 GTGAGGTAAATGCAGGAGCAGGG + Intronic
979926373 4:126570150-126570172 TTGGCGTAACAGGAGGTGCAGGG - Intergenic
984223704 4:177008474-177008496 GTGTAGATACAGCAGTAGCATGG - Intergenic
987233828 5:15923063-15923085 ATGTCGTAAGACCAGGAGGAGGG + Intronic
987264572 5:16239307-16239329 TTGCAGTAACAGCAGCAGCAAGG - Intergenic
988654540 5:33194196-33194218 GTGTCATATCAGCAAGAGCTGGG + Intergenic
991299053 5:65110621-65110643 TTGTCATAACAGCATAAGCAAGG + Intergenic
993932325 5:93955009-93955031 GTGTCCTGGCAGCAGCAGCATGG - Intronic
997456027 5:134018231-134018253 ATGTGGCAAGAGCAGGAGCAAGG + Intergenic
1002694190 5:181073122-181073144 GTGTCGGAGAAGCAGGAGGATGG + Intergenic
1006996371 6:38264925-38264947 GTCTCCTAATAGCAGGAGGAGGG + Intronic
1018834466 6:167472623-167472645 GTAGCATAAGAGCAGGAGCAAGG + Intergenic
1019814870 7:3192263-3192285 GTTGGGTAACAGCAGGAGAAAGG + Intergenic
1028795208 7:94894522-94894544 TTGTCCTAAAAGCAGAAGCAAGG - Intergenic
1030516847 7:110549887-110549909 GTGTGGTGAAAGCAGGAGCAAGG + Intergenic
1037792627 8:21959532-21959554 GTGACCTAGCAGCAGGAACAAGG - Intronic
1049746134 8:144264114-144264136 GCGTGGGAACAGCAGGAGCCAGG - Exonic
1055361716 9:75497937-75497959 GGGTGGTAAAAGCAGAAGCAAGG + Intergenic
1059453454 9:114385398-114385420 CTGCCATAACAGCAGGAGCCAGG - Intronic
1059637222 9:116182833-116182855 GTTCCGTAACAGGAGGACCATGG + Intronic
1061363448 9:130158000-130158022 GGGTCGACACAGCAGGAACAAGG - Intergenic
1194851547 X:98875932-98875954 GTGGGGTATCCGCAGGAGCAGGG + Intergenic
1197303236 X:124806825-124806847 ATGTGGTGAGAGCAGGAGCAAGG + Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1198848344 X:140937857-140937879 GTGACATAACAGAATGAGCATGG - Intergenic
1199860652 X:151798083-151798105 TTGACCTAACAGCACGAGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1201868068 Y:18676256-18676278 GTGTAGAAACAGCAGGTGTATGG - Intergenic