ID: 1185299352

View in Genome Browser
Species Human (GRCh38)
Location 22:50071564-50071586
Sequence GGAAATCCTGTCCCACACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185299352_1185299359 6 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299359 22:50071593-50071615 TGAGCCTTGGGGAGCCTCGGAGG No data
1185299352_1185299355 -6 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299355 22:50071581-50071603 ATTTCCTCATGATGAGCCTTGGG No data
1185299352_1185299358 3 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299358 22:50071590-50071612 TGATGAGCCTTGGGGAGCCTCGG No data
1185299352_1185299363 27 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299363 22:50071614-50071636 GGAGACTCTGCAGTGCCCCAGGG No data
1185299352_1185299356 -5 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299356 22:50071582-50071604 TTTCCTCATGATGAGCCTTGGGG No data
1185299352_1185299354 -7 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299354 22:50071580-50071602 GATTTCCTCATGATGAGCCTTGG No data
1185299352_1185299362 26 Left 1185299352 22:50071564-50071586 CCTCCGTGTGGGACAGGATTTCC No data
Right 1185299362 22:50071613-50071635 AGGAGACTCTGCAGTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185299352 Original CRISPR GGAAATCCTGTCCCACACGG AGG (reversed) Intronic