ID: 1185299896

View in Genome Browser
Species Human (GRCh38)
Location 22:50074124-50074146
Sequence GAATGCACCAAGACTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185299893_1185299896 10 Left 1185299893 22:50074091-50074113 CCAGCGAGGACCCTCTGTGGTGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1185299896 22:50074124-50074146 GAATGCACCAAGACTGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 135
1185299894_1185299896 0 Left 1185299894 22:50074101-50074123 CCCTCTGTGGTGACTCTCTGTCT 0: 1
1: 0
2: 0
3: 26
4: 258
Right 1185299896 22:50074124-50074146 GAATGCACCAAGACTGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 135
1185299895_1185299896 -1 Left 1185299895 22:50074102-50074124 CCTCTGTGGTGACTCTCTGTCTG 0: 1
1: 0
2: 3
3: 29
4: 424
Right 1185299896 22:50074124-50074146 GAATGCACCAAGACTGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185299896 Original CRISPR GAATGCACCAAGACTGAGCT CGG Intronic
901463716 1:9407126-9407148 GTCTGCACCAACACTGGGCTGGG - Intergenic
901819703 1:11820242-11820264 TAATGCACCATGACTGTGCCTGG + Intronic
902777460 1:18684005-18684027 GAATCCAGCCAGACTGAGCCCGG + Intronic
904700512 1:32355182-32355204 GAATGCCCCAATACTGGGGTTGG - Intronic
905625884 1:39490724-39490746 GAAGGCACCTAGACTGCACTGGG - Intergenic
905650309 1:39652091-39652113 GAACACACAAAGGCTGAGCTAGG + Intergenic
905670989 1:39789602-39789624 GAAGGCACCTAGACTGTACTGGG + Intergenic
909318626 1:74253856-74253878 GAAGGCACCAAGAGCGAGCGAGG + Intronic
911512559 1:98825808-98825830 GAATTCTCCAAGACTAAACTTGG - Intergenic
915526278 1:156478253-156478275 CAGTGCCCCAAAACTGAGCTGGG + Intronic
916114979 1:161478893-161478915 GAAGGCACCAAGAGCGAGCGAGG - Intergenic
916125568 1:161567739-161567761 GAATGCAGCAAGACTGAGGCAGG + Intergenic
918319194 1:183348801-183348823 GAAAGCATCAAGACTGAAATAGG - Intronic
920680099 1:208065709-208065731 GAATGCCCGAAGCCTGAGCTTGG + Intronic
922339604 1:224644868-224644890 GCATGCACCTCCACTGAGCTGGG + Intronic
1066477839 10:35765092-35765114 GAAGTCACCAGGACTGAGCCAGG - Intergenic
1073073477 10:100809173-100809195 GCATCCACCAACCCTGAGCTGGG + Exonic
1073208785 10:101782334-101782356 GAAGTCATCCAGACTGAGCTGGG + Exonic
1074548578 10:114422109-114422131 GAATGAAACAAGTCTGAGATTGG - Intergenic
1075538944 10:123296198-123296220 GCATGCATCTACACTGAGCTGGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1082010744 11:47448354-47448376 GAAGGCTGCAAGCCTGAGCTTGG - Intronic
1083824995 11:65195939-65195961 CAAAGCACCAAAACTGACCTAGG - Intronic
1084114130 11:67031925-67031947 GAATACACCAAGCCTTAGCAGGG + Intronic
1087008816 11:93494547-93494569 GAATGCACCACTGCTGAGCATGG + Intronic
1087682413 11:101231844-101231866 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1087716423 11:101613800-101613822 TAATGCAACGAGGCTGAGCTGGG - Intronic
1090434770 11:126677589-126677611 GAATGCAGCCAGACAGAGCTGGG - Intronic
1093290478 12:17314463-17314485 GAAGGCACAAAGAATGAGGTTGG + Intergenic
1097159249 12:57034621-57034643 GAATGCAGCAAGCATGATCTCGG - Intronic
1098127295 12:67311822-67311844 CAATACACCAAGTCTGACCTAGG - Intronic
1099190889 12:79561392-79561414 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1103550290 12:121732226-121732248 GAATCCACGAAGACTGGGCGTGG + Intronic
1104431507 12:128720140-128720162 GAAGGCACCACTACAGAGCTGGG - Intergenic
1104806638 12:131593432-131593454 GAATGCATCTAGACTGGTCTAGG + Intergenic
1105862921 13:24432813-24432835 GAATGTGCTAAGCCTGAGCTTGG + Intronic
1113974799 13:114219645-114219667 GTAGGCTCCAAGACAGAGCTGGG + Intergenic
1114566289 14:23635652-23635674 GGAGGCACCAAGAGTGAGCAAGG - Intronic
1115805607 14:37047689-37047711 AAATGCACCAAGACTCATTTTGG - Intronic
1115974650 14:38983023-38983045 GACAGCACCAACACTGTGCTGGG - Intergenic
1116084458 14:40217306-40217328 GGAGGCGCCAAGAGTGAGCTAGG + Intergenic
1119728428 14:76936275-76936297 GAAGACAGCAAGACTGGGCTGGG - Intergenic
1119746491 14:77048253-77048275 GAATGCTCCAAGATTTTGCTGGG - Intergenic
1123933041 15:25181076-25181098 CAATGCACTGAGACTCAGCTGGG - Intergenic
1126070384 15:44860759-44860781 GAATGCAAAGAGACTGAGTTTGG - Intergenic
1126087651 15:45024358-45024380 GAATGCAAATAGACTGAGTTTGG + Intronic
1128644242 15:69363210-69363232 GAATGCACCAAGAATGGACCAGG - Intronic
1129586925 15:76876321-76876343 GGAGGCACCAAGAGTGAGCGAGG + Intronic
1132795927 16:1722574-1722596 GACTGCACCCAGCCTCAGCTGGG - Intronic
1136007713 16:27342307-27342329 GTTTGCCCCAAGAGTGAGCTGGG + Intronic
1138042074 16:53682639-53682661 GACTGCCCCAAGCTTGAGCTTGG + Intronic
1144052096 17:11505632-11505654 GAATGAACAAAGACTGAACCAGG + Intronic
1148693149 17:49544583-49544605 GAATGTGCCAAGGCTGAACTCGG + Intergenic
1150630807 17:66879153-66879175 GAATGCCCTTAGACTCAGCTGGG + Intronic
1152706073 17:81844342-81844364 GAAGGGTCCAAGGCTGAGCTGGG - Intronic
1166116570 19:40659203-40659225 GAATGTAAAAAGACTGGGCTGGG - Intergenic
925783708 2:7407737-7407759 GATTTCTCCAAGACTCAGCTAGG + Intergenic
929669049 2:43854741-43854763 GCATGGTCCTAGACTGAGCTGGG + Intronic
930149082 2:48039842-48039864 GAATGCAAGAAGACTGGGCTTGG - Intergenic
931633983 2:64325811-64325833 GAATGCAGCAAGAGAGAGTTAGG + Intergenic
937625493 2:124038866-124038888 GCATGGACCATGACTGAGGTGGG - Intronic
938876833 2:135540535-135540557 GCATGCACCAGCACTGAGGTGGG - Intronic
940477522 2:154183236-154183258 CAATTCACAAAGACTGAACTAGG - Intronic
941409504 2:165136431-165136453 GAAAGCACCTAGACTGTGCCTGG - Intronic
942762353 2:179414200-179414222 CAATCCCCCAAGACTGAACTAGG + Intergenic
943203559 2:184860855-184860877 GAATGCGCCAGCACTGAGCTTGG - Intronic
944437906 2:199711154-199711176 AAATGCAGCCAGACTGAGCGAGG + Intergenic
945194064 2:207221904-207221926 GAAAGCCCAAAGCCTGAGCTTGG + Intergenic
945451556 2:210001076-210001098 GAAGGCACCGAGAGTGAGCGAGG + Intergenic
946227520 2:218272069-218272091 GAAGGAACTGAGACTGAGCTAGG + Intronic
1174484088 20:50850747-50850769 GCAGGCACCAAGAGTGAGCACGG - Intronic
1176344897 21:5733964-5733986 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176351711 21:5854548-5854570 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176499930 21:7590491-7590513 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1176539218 21:8132034-8132056 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176558169 21:8315079-8315101 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1179969877 21:44829673-44829695 GAATGAATCAACCCTGAGCTGGG + Intergenic
1182925752 22:34123029-34123051 TAAAGCACCCAGACAGAGCTTGG - Intergenic
1183510362 22:38231017-38231039 GAAAGCACTAAGACTGAGACAGG + Intronic
1183724800 22:39582589-39582611 GAGGGCACCAAGACTGAGAGTGG + Intronic
1183990280 22:41593378-41593400 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1184203738 22:42987134-42987156 CAAAACACCAAGACTGACCTGGG + Intronic
1184322521 22:43753343-43753365 GAATGCGCCAGGACTTAGCGTGG + Intronic
1185299896 22:50074124-50074146 GAATGCACCAAGACTGAGCTCGG + Intronic
1203244167 22_KI270733v1_random:48389-48411 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
951097962 3:18653576-18653598 GCATGTACCAAGACTCTGCTTGG - Intergenic
951174134 3:19579388-19579410 GAATGCAACACTACTGGGCTTGG - Intergenic
952186177 3:30971595-30971617 GAATGTATCAAGAAAGAGCTGGG + Intergenic
960986735 3:123285869-123285891 GAGTGGACCAGGACTGTGCTTGG + Intronic
965139798 3:164818327-164818349 GGAAGCACCAAGAGTGAGCGAGG - Intergenic
966187814 3:177244032-177244054 GACTGAACCTAGACAGAGCTGGG - Intergenic
966640475 3:182183970-182183992 CAATGCACCCAAACTGAGCATGG - Intergenic
969736350 4:8993356-8993378 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
971061322 4:22974317-22974339 CAATCTACCAAGACTGAACTAGG - Intergenic
972044294 4:34644823-34644845 TAATGGACCATGACTAAGCTGGG + Intergenic
972505857 4:39719010-39719032 GGAGGCACCAAGAGTGAGCAAGG + Intronic
973828501 4:54734251-54734273 GAATTCATCAAGACTGGGCCTGG - Intronic
973878051 4:55241355-55241377 GGAGGCACCAAGAATGAGCAAGG - Intergenic
974089957 4:57300677-57300699 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
974129052 4:57730398-57730420 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
978490662 4:109308199-109308221 GAATGCAGGCAGACTGGGCTTGG - Intergenic
984924012 4:184790930-184790952 GAAGGCACCAAGGCTAAGGTAGG + Intronic
988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG + Intergenic
988809268 5:34768257-34768279 GAATGCCCCAACACTGGGCTAGG - Intronic
991633605 5:68681047-68681069 GAAGGCACCAAGAAGGAGATGGG - Intergenic
993803616 5:92375391-92375413 GAAGGCACCGAGAGTGAGCGAGG + Intergenic
994024874 5:95070742-95070764 GAATTCACCAAGCCGCAGCTGGG - Intronic
996036550 5:118764851-118764873 GACTGAACCAAGACTGAACCAGG + Intergenic
996335250 5:122377238-122377260 GAATACACCAAGACAGAGAAAGG - Intronic
997796159 5:136813646-136813668 GAAGGCAGCAGGACTGAGCAGGG + Intergenic
998353579 5:141516462-141516484 AAATCCAGCAAGACTGACCTAGG + Exonic
999654744 5:153800717-153800739 GGATTCAGCAGGACTGAGCTTGG - Intronic
1001758669 5:174190026-174190048 GAAAGAACCAAGACAGATCTTGG - Intronic
1002136163 5:177108999-177109021 GAATGCTCCTAGACTTCGCTGGG - Intergenic
1008589428 6:52978375-52978397 GATAGCACCATGACAGAGCTGGG + Exonic
1009524551 6:64728060-64728082 GAATGCAGTGAGACTGAGCCAGG - Intronic
1009873104 6:69472935-69472957 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1014299624 6:119665533-119665555 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1015488302 6:133796875-133796897 CACTGTCCCAAGACTGAGCTAGG - Intergenic
1017017853 6:150116139-150116161 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1019779961 7:2933600-2933622 GACTGCACCAAGACTGAATTTGG + Intronic
1021539730 7:21743936-21743958 GAAAGCACCATGAGTGAGCAAGG + Intronic
1028434221 7:90782744-90782766 GAATCCACAAAGACTAAACTAGG - Intronic
1028698542 7:93747382-93747404 GAATGGAGCAAGAGTGAGATGGG - Intronic
1031902793 7:127429017-127429039 GGAGGCACCAAGAGTGAGCGAGG - Intronic
1033291452 7:140087117-140087139 GAATGCACAAAGACAGCTCTGGG - Exonic
1039416840 8:37402394-37402416 GAATGCAGCAAGGCTGTGGTAGG - Intergenic
1040953941 8:52961247-52961269 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1043655313 8:82657516-82657538 ACATGAACCAAGACTGAGGTAGG - Intergenic
1047163315 8:122406914-122406936 TAATGGACCAAGACTGGGCTGGG + Intergenic
1048444808 8:134485370-134485392 GAATGAAAAAAGACTGTGCTGGG - Intronic
1050022140 9:1295164-1295186 AAATGAAGCCAGACTGAGCTAGG - Intergenic
1050163359 9:2740477-2740499 GAATGCAGCAATAAGGAGCTAGG + Intronic
1050416334 9:5421217-5421239 GAATGCAGAGACACTGAGCTGGG - Intronic
1060062220 9:120470977-120470999 GAAGAAACCAAGACTCAGCTGGG - Intronic
1060579277 9:124729711-124729733 GGAAGCATCAAGACTGAGATGGG - Intronic
1061271491 9:129546140-129546162 GAAGGCACCAAGACAGAGACTGG + Intergenic
1062723124 9:138054800-138054822 GAAAACACCAAGATTTAGCTAGG - Intronic
1203460498 Un_GL000220v1:31476-31498 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1194554872 X:95344347-95344369 GCATTCGCCAAGACTCAGCTAGG - Intergenic
1200383475 X:155865227-155865249 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1200763177 Y:7058429-7058451 GGATATAGCAAGACTGAGCTTGG + Intronic
1201634705 Y:16109852-16109874 GAATCTACCAAGTCTGATCTTGG - Intergenic
1202574990 Y:26314469-26314491 GAATGCACTGAGGCTCAGCTAGG - Intergenic