ID: 1185300381

View in Genome Browser
Species Human (GRCh38)
Location 22:50076918-50076940
Sequence AAGAAACAGAACTGTCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185300377_1185300381 13 Left 1185300377 22:50076882-50076904 CCAGAATGTTGGCGCTGTCAGAC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1185300381 22:50076918-50076940 AAGAAACAGAACTGTCACCCCGG 0: 1
1: 0
2: 3
3: 40
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185300381 Original CRISPR AAGAAACAGAACTGTCACCC CGG Intronic
903167759 1:21532863-21532885 AAGAATCAGGACAGGCACCCTGG - Intronic
903424513 1:23243973-23243995 CCGGAACAGAACTGACACCCAGG - Intergenic
903687354 1:25141554-25141576 AAAAAAAAGAACTATCAGCCAGG + Intergenic
904201797 1:28824611-28824633 AAGAAAAAGAACCATCAGCCAGG - Intronic
904479613 1:30785677-30785699 AAGAAAAGGAACTGGCACCTCGG + Intergenic
904785935 1:32983016-32983038 TAGAACCAGAACTGGAACCCAGG - Intergenic
905032220 1:34893245-34893267 AAGAAAAATAACTGTCAGCCAGG + Intronic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
907011240 1:50965498-50965520 AAAAAAAAGAACTTTCAGCCTGG + Intronic
907621957 1:55990687-55990709 GAGATACAGAACTGGCAGCCAGG + Intergenic
908361468 1:63372683-63372705 AAAAAAAAGCTCTGTCACCCAGG + Intronic
908692437 1:66797446-66797468 AAGACACAGACCTGTCTCCTGGG + Intergenic
909989423 1:82204697-82204719 AAGAAAAAAAACTGTCAACATGG + Intergenic
910826290 1:91411003-91411025 AGGCAGCAGAACTGTCACCATGG + Intergenic
911130340 1:94381391-94381413 AAGGCACAGACCTGTCTCCCAGG + Intergenic
912363787 1:109116258-109116280 AAGTAACAGGACTGAAACCCTGG - Intronic
912780511 1:112542727-112542749 TAGAGACAGGTCTGTCACCCAGG - Intronic
913432343 1:118809089-118809111 AAAAACCACAACTGTCACCTGGG + Intergenic
915110069 1:153558466-153558488 AAGATACATAACTGCCATCCAGG - Intergenic
916679755 1:167093596-167093618 AAGAAAAAGAAATGTAATCCTGG + Intergenic
918127159 1:181594691-181594713 AAGAAACAAAACTTGCAGCCAGG - Intronic
919159371 1:193808266-193808288 AAGAAACAGAAGTGATACCAAGG + Intergenic
919349583 1:196432281-196432303 AAGAAAGAGAACTACCACCGGGG + Intronic
919646650 1:200101726-200101748 AAGAAACAGAAAAGTCTACCAGG + Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
922130662 1:222774117-222774139 AAAAAAGAGAACTGATACCCAGG + Intergenic
922757522 1:228104857-228104879 AAGAAACAGAAATTTCCCACAGG - Intronic
923039886 1:230312184-230312206 AAAAAACAGAACCATCTCCCAGG - Intergenic
923265829 1:232313179-232313201 AATAAACAGAAGTAGCACCCAGG + Intergenic
923631548 1:235651831-235651853 AAGAAAGAAAACTGATACCCAGG - Intergenic
923729218 1:236534258-236534280 AGGAAACATAACAGACACCCAGG - Intronic
924421763 1:243916688-243916710 AAGCAAGAGAACTTCCACCCGGG + Intergenic
924560151 1:245151922-245151944 AAGAAAAATAACTGTCAATCAGG + Intergenic
924640741 1:245831169-245831191 AAGATACAGAACTGTCATCATGG - Intronic
1063581422 10:7311088-7311110 AACAAACTAAACTGTCAGCCAGG + Intronic
1063931258 10:11030532-11030554 AAGAAACAGAAGTGCGACCTCGG - Intronic
1064143936 10:12812628-12812650 AAAAAAAAGAACTGCCACCGTGG + Intronic
1065916658 10:30358817-30358839 AAGTCACAGAACAGCCACCCAGG - Intronic
1067094197 10:43287479-43287501 AAGAAACAGAACAGTCACACCGG + Intergenic
1067540715 10:47150368-47150390 AAGAAAATGAACAGTCTCCCTGG + Intergenic
1068036317 10:51764499-51764521 AAGAAAGAAAACTGTCAAGCTGG + Intronic
1068101286 10:52556795-52556817 AAGAAACCTAATTGTCACTCAGG + Intergenic
1069644414 10:69982243-69982265 AAAAAAAAAAACTGTCAGCCAGG + Intergenic
1069819609 10:71219221-71219243 AAGAGACAGGACTGGGACCCAGG + Intronic
1070885858 10:79897641-79897663 AAGAAAAAGAACTTTTACCAAGG - Intergenic
1071257279 10:83882202-83882224 AAGAAACTGAACTGTAACTAAGG - Intergenic
1071509593 10:86253174-86253196 AAAAGACAGAGCTGTCAGCCTGG - Intronic
1072168935 10:92841718-92841740 AATAAGCAAAACTGTCCCCCTGG - Intronic
1073185898 10:101614868-101614890 AACAAACAGAAATGGCACCGTGG + Intronic
1074405358 10:113176688-113176710 TAGAAACAGAGCTGTCCCACTGG + Intergenic
1076280615 10:129243264-129243286 AGGAAACAGAAATGGCAGCCTGG + Intergenic
1077062281 11:623011-623033 AAGAAACTGGATTGTCAGCCGGG + Intronic
1080630207 11:34067524-34067546 AAGATACTGTGCTGTCACCCAGG + Intronic
1081599658 11:44484295-44484317 AGGAAGCAGCACTGTCCCCCAGG + Intergenic
1081860162 11:46328701-46328723 AAAAAAAAGAACTGACAGCCAGG + Intergenic
1082869176 11:57928202-57928224 AATAATCAGAACAGACACCCAGG - Intergenic
1084079349 11:66810471-66810493 AAGGCACAGACCTGTCTCCCAGG - Intronic
1085431286 11:76451091-76451113 AAGAAATAAAACTGTCAGGCCGG - Intronic
1085648533 11:78245445-78245467 AGAAAACAGAACTGTCATTCTGG + Intronic
1087796112 11:102455880-102455902 AAGAAACAGAGCTGTAAACTAGG - Intronic
1090019575 11:123115675-123115697 AAGAAATAGAACCGGCACCTTGG - Intronic
1090967988 11:131615168-131615190 AAGAGACAGAACTAGCACCCAGG - Intronic
1091492772 12:947589-947611 AAAAAACAAAACTCCCACCCAGG + Intronic
1094018565 12:25889877-25889899 AAGGCACAGACCTGTCTCCCAGG - Intergenic
1094324830 12:29225977-29225999 AAGAGCAAGAACTGTCACCCAGG - Intronic
1097276564 12:57817634-57817656 GAGACAGAGAACTGTCACCCTGG + Intronic
1097967960 12:65601647-65601669 AAGACACAGCACTGTAATCCAGG + Intergenic
1099870732 12:88346329-88346351 AAGAAAATGAACTGTCTCTCAGG + Intergenic
1101225130 12:102680743-102680765 AAGAAACTGAAATGTCAGCATGG - Intergenic
1101361725 12:104033841-104033863 CAGAGACAGGATTGTCACCCAGG + Intronic
1101735119 12:107457681-107457703 AAAAAGCAGCACTGTCACCCAGG + Intronic
1101748507 12:107562982-107563004 ATGAAACAGAAATGTCAGACTGG - Intronic
1101993446 12:109506644-109506666 AAGAAACAGATTTGGCAGCCCGG - Intronic
1102368317 12:112359188-112359210 AAAAAAAAGAACTGCCACTCAGG + Intronic
1102513631 12:113432184-113432206 AACAAACAAACCTGTCAGCCAGG - Intronic
1102819592 12:115896289-115896311 AAGACCCAGAATTGTCACCAAGG - Intergenic
1102823465 12:115927188-115927210 AAGAACAAGAAGTGCCACCCAGG + Intergenic
1103026602 12:117579297-117579319 AAGAAACAGGACTGGAATCCAGG - Intronic
1103152567 12:118653903-118653925 AAGAAACAGAATTTGAACCCAGG - Intergenic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103712044 12:122919857-122919879 AACAAACAGATGAGTCACCCAGG - Intergenic
1104354457 12:128072983-128073005 GAGAAAAAGAACTCTCACTCTGG + Intergenic
1104488863 12:129176801-129176823 AAGAAATAGAACTCTGTCCCTGG + Intronic
1106029768 13:25989619-25989641 AAGAAAAGGAAATGTCAGCCAGG - Intronic
1110343788 13:74422952-74422974 AAGAATCAGATTTGTCAGCCTGG - Intergenic
1110782914 13:79487211-79487233 AAAAATCAGAACAGTCACCTGGG - Intronic
1111403566 13:87771721-87771743 AAGAAACAGAACTTTCTCAAGGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1112401072 13:99078737-99078759 AAGAAAAAGAACTATCTCTCAGG + Intronic
1113194794 13:107789730-107789752 CAAAATCAGAACTGGCACCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114309353 14:21452688-21452710 TAGAAATACAACTGTCAGCCGGG + Intronic
1114309395 14:21453010-21453032 AAGAAATACAACTGTCAGGCTGG + Intronic
1114629494 14:24150109-24150131 AAGAAAGAGAGCTGTCTCCCAGG - Exonic
1116345975 14:43794600-43794622 AAGAAATAGAACTGTTTTCCAGG - Intergenic
1117292787 14:54349697-54349719 AGGAAACATAACTGTCACAGAGG + Intergenic
1117540872 14:56745518-56745540 AAGAAAGAGGACTGACTCCCTGG - Intergenic
1118780232 14:69003074-69003096 AAGAAACGGAACCGTCAAGCTGG - Intergenic
1118945206 14:70379058-70379080 AAGGAACATACCTGTCTCCCAGG + Intronic
1119019395 14:71094769-71094791 AAGAAACAGAAATATTAGCCAGG + Intronic
1119030768 14:71190692-71190714 AAGAAATAGAGCAGTCACACTGG + Intergenic
1122380411 14:101300245-101300267 AAGACATAGAACTGTCTCCCGGG + Intergenic
1126730146 15:51674189-51674211 AGGAACAAGAACTGTCACCTTGG + Intergenic
1127693989 15:61426101-61426123 AAGAAACAGCCCTGACACTCTGG + Intergenic
1128285065 15:66429850-66429872 AACAAAAAGAACTGGCACCATGG - Intronic
1128512596 15:68322510-68322532 AAGAAACTCAGCTGACACCCTGG - Intronic
1128766843 15:70256413-70256435 AAGAAACAGAAGTATCACAGAGG + Intergenic
1128864089 15:71099936-71099958 AACAAAGAAAACTGTCACCCAGG - Intronic
1129853440 15:78808906-78808928 AAGTGACAGTTCTGTCACCCAGG - Intronic
1130022820 15:80245330-80245352 AAGAACCAGAACTGTCTCTTCGG - Intergenic
1134374970 16:13663562-13663584 CAGAAACAGAACTCTAACCTAGG - Intergenic
1137473012 16:48778777-48778799 TTGAGACAGAGCTGTCACCCAGG - Intergenic
1138649709 16:58452745-58452767 AAGAAAAAGAACAGAGACCCTGG + Intergenic
1138936536 16:61732482-61732504 ATGAAACATAACTGTCAGCCAGG + Intronic
1139919897 16:70453085-70453107 AAGGTACAGACCTGTCTCCCAGG - Intergenic
1140986927 16:80166708-80166730 AAGAAACAGTACAGTTCCCCTGG - Intergenic
1141853617 16:86665660-86665682 AAGAGACAGAACTGCCGCCAAGG + Intergenic
1142070270 16:88088006-88088028 AAATAACAGAACAGTGACCCAGG + Intronic
1144024991 17:11269677-11269699 AAGAAACAGAACTGTTGTTCTGG + Intronic
1144125423 17:12198342-12198364 AAGGAACAGGGCTGTCACCCTGG + Intergenic
1144795136 17:17886256-17886278 CAGGAACAGTACTGTCAGCCCGG + Intronic
1146204583 17:30891666-30891688 AAGAAACAGTAATTTCAGCCGGG - Intronic
1147942498 17:44059003-44059025 AAGAAACAAAACAACCACCCAGG + Intronic
1149353420 17:55814820-55814842 AACTAGCAGAACTGTCATCCAGG + Intronic
1150006667 17:61474039-61474061 AAGAAAGAAAACTGAGACCCCGG - Intronic
1150459759 17:65339657-65339679 AACAAACAGAACAGTCAAGCAGG + Intergenic
1151094769 17:71484277-71484299 AGGCAACAGAACTATTACCCAGG + Intergenic
1151699444 17:75735380-75735402 AAGAAATAAAACTGTCAGCCGGG - Intronic
1152984172 18:307001-307023 AAGACATAGACCTGTCTCCCAGG + Intergenic
1153199983 18:2638091-2638113 AAGAAACAGAAATTTAGCCCGGG + Intergenic
1156215753 18:34996474-34996496 AAGACACAGAACAGCCACCCAGG - Intronic
1156519242 18:37707732-37707754 AAGAAACCTAGATGTCACCCCGG + Intergenic
1157485239 18:48082427-48082449 ATGAGACGGAGCTGTCACCCAGG + Intronic
1158281993 18:55838533-55838555 AGGAAACAGAAACATCACCCAGG + Intergenic
1158644234 18:59230163-59230185 GAGAACCAGAGCTGTCCCCCAGG - Intronic
1159329565 18:66973243-66973265 AAAAAACAGAACTATCAGCCTGG + Intergenic
1160415635 18:78708482-78708504 GAGAAAAAGAACTGTCAACCAGG - Intergenic
1160552982 18:79706900-79706922 AAGAAACATCACTGGCATCCTGG - Intronic
1161618455 19:5285699-5285721 AGGTAACAGAACTGGCACACTGG + Intronic
1162336342 19:10062906-10062928 AATGAAAAGAAATGTCACCCTGG + Intergenic
1165414359 19:35683024-35683046 AAAAAACAGAACTGGCAGCGGGG + Intergenic
925208624 2:2027745-2027767 AAGACTCAGAGATGTCACCCAGG - Intronic
925478071 2:4241434-4241456 AAAGAAAAGAACTGTCAACCTGG - Intergenic
925502312 2:4519057-4519079 CAGTAACAGAACTGTCCCCTGGG + Intergenic
925529520 2:4843829-4843851 AAGAAACAGGACTTTCAAACGGG + Intergenic
925571753 2:5319654-5319676 AAGAAGAAGCAGTGTCACCCAGG + Intergenic
925674959 2:6352652-6352674 GTGAAGCAGCACTGTCACCCTGG - Intergenic
926363106 2:12108698-12108720 AAGCAAGAGAAAAGTCACCCTGG + Intergenic
927641993 2:24851300-24851322 CAAAGACAGAACGGTCACCCTGG + Intronic
931441413 2:62293274-62293296 AGGCCACAGAGCTGTCACCCCGG + Intergenic
932320887 2:70821240-70821262 AAAAAACACTCCTGTCACCCAGG - Intergenic
932970849 2:76539263-76539285 AAGGAAAAGAACTATCAACCTGG + Intergenic
933177176 2:79188405-79188427 AAGAGGCAGAAGTGTCACCTGGG + Intronic
933430815 2:82175870-82175892 AAGAAACAGAACTGTGAATTTGG - Intergenic
933717754 2:85374066-85374088 AAAAAAAAGAACTGTCAACCTGG - Intronic
933750841 2:85601486-85601508 TGGGAACAGAACTGTCACCCTGG + Intronic
933796541 2:85924540-85924562 AAGAAACAGTGGTGTGACCCTGG + Intergenic
934300312 2:91772789-91772811 AAGAAACAGACTTGTCTGCCTGG - Intergenic
934493089 2:94775491-94775513 AAAAAACACAACTGTGACACAGG + Intergenic
934542655 2:95188859-95188881 TAAAAACAGAACTCTCAGCCAGG + Intergenic
934900336 2:98154837-98154859 GTGAAACGGATCTGTCACCCTGG - Intronic
935014729 2:99170596-99170618 AAGAAATAGAAGAGTCACTCAGG - Exonic
935528396 2:104201345-104201367 AAGTAACAGAAATGGCACCTGGG - Intergenic
935782097 2:106517392-106517414 AAGAAACAAAAATGTCAGCAGGG - Intergenic
935897959 2:107757849-107757871 AATAAAAAGAACTTTCCCCCAGG - Intergenic
936019285 2:108982452-108982474 AATAAACAGAACTGAGACACTGG - Intronic
937685685 2:124693863-124693885 AAGAAACACAACAGTCAAGCTGG - Intronic
938675802 2:133632697-133632719 AAGAAACAGAAATGACATCTTGG - Intergenic
939410518 2:141818829-141818851 AAGATACAGAAATGTTATCCAGG - Intronic
940836832 2:158531226-158531248 GAGAAACAGAAATGTCACTGGGG - Intronic
940861329 2:158773368-158773390 AAGAAACTGATCTGTGACTCAGG - Intergenic
941011228 2:160302218-160302240 TAAAGACAGATCTGTCACCCAGG + Intronic
941237740 2:162996085-162996107 AAGGGAAAGAATTGTCACCCAGG + Intergenic
942253776 2:174071221-174071243 AAGATACAGAAATGTTCCCCTGG + Intergenic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
945470062 2:210218304-210218326 TTGAGACAGGACTGTCACCCAGG + Intronic
945522249 2:210843393-210843415 AAGAAACAAGAATGTTACCCAGG + Intergenic
946183156 2:217960941-217960963 AAGGAAAACAACTGGCACCCAGG + Intronic
946765917 2:223040543-223040565 ACGACACAGACCTGTCTCCCAGG + Intergenic
946823267 2:223651289-223651311 AAGAAAATGAACTGTCTACCTGG - Intergenic
947255351 2:228157877-228157899 AAGAAAAAAAAATGTCACCAAGG + Intronic
1170291443 20:14774071-14774093 AACAAACAGAACTGTAACTTTGG - Intronic
1170921660 20:20685298-20685320 AAGTAACAGAACAGGCACCATGG + Intronic
1171285110 20:23930468-23930490 AAAAAACAGAACTCTAGCCCAGG + Intergenic
1172002137 20:31787548-31787570 AAGGTACAGACCTGTCTCCCAGG - Intronic
1172359281 20:34301171-34301193 CAGAACCAGAACTGGCAGCCAGG + Intronic
1172778320 20:37420991-37421013 AAGAAACAAAACTGTCGCAGAGG - Intergenic
1175058077 20:56216388-56216410 AAGAAATAGAATTTTCAGCCAGG + Intergenic
1175226381 20:57446576-57446598 AAGACATAGACCTGTCTCCCAGG - Intergenic
1175315920 20:58046596-58046618 AAAAATCAGAAATGTCTCCCAGG - Intergenic
1177238451 21:18424010-18424032 AAGAAAGAGAAGTTTCAGCCTGG + Intronic
1177275953 21:18913305-18913327 AAGATCCAGAAATGTCATCCAGG + Intergenic
1178997053 21:37412306-37412328 GAGACACAGAACTTTCAACCTGG - Intronic
1179812855 21:43883467-43883489 AAGGAACAGAAATGGCTCCCGGG - Intronic
1180684828 22:17657809-17657831 AAAAAAAAGAAATGTCAACCAGG - Intronic
1180722720 22:17921355-17921377 AAGGCATAGAACTGTCTCCCGGG + Intronic
1181449348 22:23008047-23008069 AATAAACACCACTGTCTCCCAGG - Intergenic
1182007365 22:26972025-26972047 AAGAACCAGAAATGACTCCCAGG + Intergenic
1183386564 22:37518742-37518764 AAGAGACAAAACTCTGACCCCGG + Intronic
1184418504 22:44365655-44365677 AAGACAGAGACCTGTCACACAGG + Exonic
1184601754 22:45548072-45548094 CAGAGACAGCTCTGTCACCCAGG + Intronic
1184608017 22:45585586-45585608 GAGACACAGCCCTGTCACCCCGG + Intronic
1184819429 22:46898381-46898403 AAGACATAGACCTGTCTCCCAGG - Intronic
1185300381 22:50076918-50076940 AAGAAACAGAACTGTCACCCCGG + Intronic
949754829 3:7397177-7397199 AAGAAACAAACTTATCACCCAGG + Intronic
949895128 3:8762842-8762864 CTGAAACAGAACTGGCAACCTGG - Intronic
951931861 3:27976590-27976612 AATAAAGAAAACTGTCTCCCAGG + Intergenic
953128603 3:40115780-40115802 AAAAAAAAGAACTGTGAACCAGG - Intronic
956102801 3:65786330-65786352 ACCAAACTGAAGTGTCACCCAGG + Intronic
956952929 3:74303109-74303131 TATAAAAAGAAGTGTCACCCTGG - Intronic
957682645 3:83457468-83457490 GAGAAGCAGAACTGTGGCCCTGG - Intergenic
959854747 3:111138597-111138619 AATAAACATAACTGTCACGAAGG - Intronic
960562767 3:119103556-119103578 AAGAAACATAACTGTTAACTGGG - Intronic
960922479 3:122761472-122761494 AAAAAGCAAAACTGTCAGCCAGG + Intronic
961090521 3:124107427-124107449 AATATACAGACCTTTCACCCAGG + Intronic
961393920 3:126572851-126572873 AAGGCACAGACCTGTCTCCCGGG - Intronic
961963616 3:130879360-130879382 AAAAAACAGAAATATCAGCCAGG - Intronic
963219706 3:142795582-142795604 AAAAAAAACAACTGTCAACCTGG + Intronic
963371936 3:144412180-144412202 AAGAAACAGAACTGTTGCTCAGG + Intergenic
963914328 3:150843654-150843676 AAGGCACAGACCTGTCTCCCAGG + Intergenic
964328727 3:155576344-155576366 AAGAAAGAGAAATCTCAGCCAGG + Intronic
965559240 3:170045837-170045859 AAGAACCAGAAATGAAACCCAGG - Intronic
966491204 3:180530194-180530216 AAGAAACAAGACTGTCTGCCCGG + Intergenic
966625248 3:182008827-182008849 AAGTTACAGAACTGGGACCCAGG + Intergenic
967054387 3:185816172-185816194 TAGACAGCGAACTGTCACCCGGG - Intronic
967956483 3:194881337-194881359 CAGAAACAGAAGCGGCACCCAGG + Intergenic
968841627 4:3010927-3010949 AAGTAACAGTACTGTCCCTCTGG + Intronic
968917133 4:3501480-3501502 CAGAAACAGAACAGTCACAATGG - Intergenic
969236719 4:5870571-5870593 AAGAATCAGTTCAGTCACCCAGG - Intronic
970424979 4:15937674-15937696 AAGAGTCAGAGCTGTCACCTGGG - Intronic
971539695 4:27800641-27800663 AAGAGACAGTACTGTCACCCTGG + Intergenic
972324823 4:38005552-38005574 AAGAAACAGAGATATCCCCCAGG - Intronic
972666146 4:41167067-41167089 AAGAAACATAAGTGTCTTCCTGG - Intronic
974797329 4:66769532-66769554 AACAAAGAGGACTGTCAACCAGG + Intergenic
975230439 4:71926156-71926178 AAGAAAGAGAACTGTGATCGAGG + Intergenic
975251104 4:72178703-72178725 AAAAAAAAGAACTGTCAACCAGG + Intergenic
975312272 4:72915757-72915779 AACAAACAGGAAGGTCACCCTGG - Intergenic
975400666 4:73934709-73934731 AAGAAACAGAAGTTTCACAGAGG + Intergenic
975835097 4:78414329-78414351 AGGAAACAGCACTGTCTTCCTGG - Intronic
977622891 4:99156938-99156960 AACTAACAGAAATATCACCCAGG - Intronic
977864513 4:102008362-102008384 AATAAACAGAACTGTAATCAAGG + Intronic
979435307 4:120681161-120681183 AAAGAAAAGAACTGTCAACCTGG + Intergenic
980453218 4:133003691-133003713 AAGAAAGAAAACTGTCAACATGG + Intergenic
981308852 4:143276071-143276093 AAGAAACTGAAATGAAACCCAGG + Intergenic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
982415208 4:155123002-155123024 AAGGTACAGACCTGTCTCCCAGG - Intergenic
982415957 4:155132249-155132271 AAGCAACTGAACTGTCAACCTGG + Intergenic
983882918 4:172953068-172953090 AATATACAGAACTGTGACACAGG + Intronic
984107174 4:175562724-175562746 CAGAAGCAGACCTGTCACTCAGG + Intergenic
985067011 4:186132533-186132555 AAGGCACAGACCTGTCTCCCTGG - Intronic
985384752 4:189434022-189434044 AAGAACCAGCAGTGACACCCAGG - Intergenic
986227250 5:5827319-5827341 AAGACACAGAAAAGTCAGCCAGG - Intergenic
986461356 5:7975726-7975748 TAAAAATAGAACTGTGACCCAGG + Intergenic
987806542 5:22776349-22776371 AAGAAACACTAGTGTCACACGGG + Intronic
987925377 5:24334543-24334565 AAGAAGAAGAGCTGTCACCAGGG - Intergenic
987976754 5:25024667-25024689 AGGAAACTGAACATTCACCCAGG + Intergenic
988311791 5:29568472-29568494 AAGAAGCAAAACTGGCACACAGG + Intergenic
988777990 5:34494478-34494500 AAGAAACAGCACAGTGATCCAGG + Intergenic
989385569 5:40851788-40851810 TTGAAAGAAAACTGTCACCCAGG - Intronic
989502111 5:42179513-42179535 AAAAAACAAAACTGCCAGCCAGG - Intergenic
989610854 5:43289965-43289987 AACAAACAAAACTATCACACAGG - Exonic
990205479 5:53424538-53424560 AAGAAAAAGAACAGTCACTTGGG - Intergenic
990506750 5:56452925-56452947 AAGAAACAGGACTTACACCCAGG - Intergenic
990968296 5:61474019-61474041 AACAAAGTGAACTGTCACCCAGG + Intronic
995389075 5:111619475-111619497 AAGAAACAGAACTAACACCCAGG + Intergenic
995679487 5:114701022-114701044 CAGAAACAAAACTGAAACCCAGG + Intergenic
998456312 5:142276564-142276586 AAAAAAAAGAAATGTCACTCAGG - Intergenic
1000244224 5:159436143-159436165 AAAAAACAGCTCTGTAACCCTGG - Intergenic
1000981981 5:167825873-167825895 AAAAAAAACAACTGTGACCCAGG + Intronic
1000998472 5:167982273-167982295 AATAAACAGAACTCACATCCAGG - Intronic
1001661515 5:173396829-173396851 AAGGAACAGAGCTGTCACTGAGG - Intergenic
1002947978 6:1780843-1780865 GAGAGACTGAACTGTAACCCAGG + Intronic
1003089497 6:3090072-3090094 AAGCAACAGCACAGTCACCTGGG + Intronic
1003777469 6:9384992-9385014 AAGAAACAGAAGGGCCGCCCTGG + Intergenic
1004385907 6:15172559-15172581 AAGAAATAACTCTGTCACCCAGG - Intergenic
1008150881 6:47949806-47949828 AAGAAACAGAACATTCAAACTGG - Intronic
1008204860 6:48642481-48642503 CAGAAACAGGATTCTCACCCAGG - Intergenic
1008708239 6:54190290-54190312 AAGAAATAGATATGTCACACAGG + Intronic
1009986709 6:70789356-70789378 AAAAAACAGATCAGTCACCAAGG - Intronic
1014942479 6:127459164-127459186 AAGAAACATACCTTTCACACTGG + Exonic
1014961788 6:127695360-127695382 AAGAGACAGCCCTGTCACCCAGG + Intergenic
1017645745 6:156538461-156538483 AAAGAACAGAACTGCCAACCTGG + Intergenic
1019054037 6:169207664-169207686 AAGAAAAAATACTGTCAACCAGG + Intergenic
1019308268 7:346688-346710 AACAAACACCACTGCCACCCGGG + Intergenic
1019636242 7:2077508-2077530 AAGCAACAGCACTGCCACACAGG + Intronic
1019636546 7:2078976-2078998 AAGCAACAGCACTGCCACACAGG + Intronic
1019846333 7:3506253-3506275 AATAAATAAAACTATCACCCTGG - Intronic
1020052311 7:5089952-5089974 AAGACATAGACCTGTCTCCCAGG - Intergenic
1021022738 7:15623981-15624003 ATAAAACAGAATTATCACCCAGG - Intronic
1021545861 7:21812376-21812398 AAGAAAATGAACTGTCCGCCGGG + Intronic
1021768034 7:23968794-23968816 AAGGCACAGACCTGTCTCCCAGG + Intergenic
1022211678 7:28216507-28216529 AAGAAAAAGTACTCTCAGCCGGG - Intergenic
1024012137 7:45277914-45277936 AAGAAATATCACTGTCAACCTGG - Intergenic
1024410829 7:49039213-49039235 AATAACCAGAAATGTTACCCAGG + Intergenic
1025729579 7:64098111-64098133 AAGATACAGACCTGCCTCCCAGG - Intronic
1029247150 7:99210394-99210416 AAGACACAGTACTGTTACCATGG - Intergenic
1031302440 7:120079412-120079434 CAGAAGCAGAACTGTCATCCAGG - Intergenic
1031468068 7:122138004-122138026 GAGAAAGAGAAGTGTCACACAGG + Intronic
1033053975 7:138032574-138032596 AAGAAACAGGCCTGTCTCCCAGG + Intronic
1033069615 7:138190248-138190270 AAGACATAGACCTGTCTCCCGGG - Intergenic
1034064308 7:148121644-148121666 AATTAACAGAACTGTCATTCTGG - Intronic
1034901954 7:154913557-154913579 AAGAACCAGCTCTGTGACCCTGG + Intergenic
1036803559 8:11811143-11811165 GAGAATTAGAACTGTAACCCTGG + Intronic
1037698593 8:21250900-21250922 AAGAAACAGAAAAATCAGCCAGG + Intergenic
1038476145 8:27869641-27869663 AAGCAACAGAACAATCACCAAGG - Intergenic
1038745730 8:30253207-30253229 ATGAGACATAACTGTGACCCAGG - Intergenic
1041456801 8:58069419-58069441 GAGATCCAGAACTGTAACCCCGG + Intronic
1041478005 8:58286712-58286734 TAGAAACATAACTATCACCCAGG - Intergenic
1042211469 8:66385542-66385564 AAAAAAAAAAACTGTCTCCCTGG - Intergenic
1043570343 8:81595667-81595689 AAGGCACAGACCTGTCACCCAGG + Intergenic
1045346684 8:101299987-101300009 AAGAGAGAGAACTGTGACCTCGG + Intergenic
1045896416 8:107223879-107223901 ATGAAACAGAACAGTCTCTCAGG - Intergenic
1047322782 8:123803596-123803618 TAAAAACAGTACTGTCAGCCTGG - Intronic
1050843194 9:10179209-10179231 AAGAAAAAGAACTTTGAGCCAGG + Intronic
1050911859 9:11081116-11081138 AATAAACATCTCTGTCACCCAGG - Intergenic
1051308013 9:15736645-15736667 AAGAAAAAGAAATGTGAGCCGGG - Intronic
1051979136 9:22992291-22992313 AAGGCACAGAACTGTCACCTAGG + Intergenic
1052095994 9:24384835-24384857 AACAAAAAGAACTGTTACCCGGG - Intergenic
1053147361 9:35720649-35720671 AAGAAAGGGCTCTGTCACCCAGG + Intronic
1053326279 9:37154640-37154662 AAAAAACAGAAAAATCACCCAGG - Intronic
1053504334 9:38628390-38628412 TAAAAACAGAAATGTGACCCTGG + Intergenic
1053615669 9:39763239-39763261 AAGAAAAAGAACTGCCAACCAGG + Intergenic
1053873837 9:42522503-42522525 AAGAAAAAGAACTGCCAACCAGG + Intergenic
1053898784 9:42772042-42772064 AAGAAAAAGAACTGCCAACCAGG - Intergenic
1054237852 9:62579152-62579174 AAGAAAAAGAACTGCCAACCAGG - Intergenic
1054268495 9:62944253-62944275 AAGAAAAAGAACTGCCAACCAGG - Intergenic
1054551983 9:66613662-66613684 AAGAAAAAGAACTGCCAACCAGG - Intergenic
1055603305 9:77942493-77942515 CAGAAACAGAACTGGCATGCTGG + Intronic
1057152100 9:92805537-92805559 TAAAAACAGAAATGTGACCCTGG - Intergenic
1059628564 9:116094281-116094303 TAGAAACAGAATTTTGACCCAGG + Intergenic
1059846975 9:118290749-118290771 AAGAAACAGAAGTTCCAACCTGG - Intergenic
1060132236 9:121114314-121114336 AAGAAAGAGAACTCTGACCAGGG + Intronic
1060836933 9:126763030-126763052 AAGAAACAGAAACGTAACCCAGG + Intergenic
1061259264 9:129470698-129470720 AAAATACAAAACTGTGACCCAGG - Intergenic
1185788294 X:2909107-2909129 AACACACAGCACTGTCACCTTGG + Intronic
1186453255 X:9690752-9690774 ACAAAAAATAACTGTCACCCAGG + Intronic
1186523297 X:10224560-10224582 AAAAAACAGAACAGTCCCCCCGG - Intronic
1186722640 X:12322195-12322217 AGGAAACAAATCTGTGACCCAGG + Intronic
1187221006 X:17325973-17325995 GAGAACCAGAACTCTAACCCAGG + Intergenic
1187398810 X:18941320-18941342 GAGAAGCAGAACTGGCACTCAGG - Intronic
1187893739 X:23961739-23961761 AAGAGAAATAACTGTCAACCTGG - Intergenic
1188661146 X:32760209-32760231 AAGAAACATTACTGTAACACAGG + Intronic
1189735033 X:44061391-44061413 AAGAAACAAAACTGTCATTGAGG - Intergenic
1192640261 X:72855765-72855787 AAGAAAGAAAACTGTCAACCCGG + Intergenic
1192641450 X:72865011-72865033 AAGAAAGAAAACTGTCAACCCGG - Intergenic
1194544675 X:95218536-95218558 CAGAAACAGAACTCTAATCCAGG - Intergenic
1195297916 X:103498376-103498398 GAGAGACAGAACTGGCAGCCTGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195581036 X:106502847-106502869 AAGGCACAGACCTGTCTCCCAGG + Intergenic
1197133705 X:123035885-123035907 AAGAAAAAGAACTGTTGCCAAGG - Intergenic
1198032819 X:132770277-132770299 AAGAATCAGAATTGGAACCCAGG + Intronic
1199082057 X:143588195-143588217 AAGGCATAGAACTGTCTCCCAGG + Intergenic
1202578344 Y:26351340-26351362 AAGGCACAGATCTGTCTCCCGGG + Intergenic