ID: 1185300438

View in Genome Browser
Species Human (GRCh38)
Location 22:50077203-50077225
Sequence GGTGAGGGGTTGGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185300438_1185300449 4 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300449 22:50077230-50077252 TCCAGAGCCCCTCCTGGCCGGGG 0: 1
1: 0
2: 4
3: 28
4: 294
1185300438_1185300447 2 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300447 22:50077228-50077250 GCTCCAGAGCCCCTCCTGGCCGG 0: 1
1: 0
2: 3
3: 46
4: 343
1185300438_1185300445 -2 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300445 22:50077224-50077246 CCCAGCTCCAGAGCCCCTCCTGG 0: 1
1: 1
2: 8
3: 85
4: 624
1185300438_1185300448 3 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300448 22:50077229-50077251 CTCCAGAGCCCCTCCTGGCCGGG 0: 1
1: 1
2: 5
3: 76
4: 565
1185300438_1185300455 19 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300455 22:50077245-50077267 GGCCGGGGTTTCTGAGACCCAGG 0: 1
1: 0
2: 3
3: 16
4: 166
1185300438_1185300458 27 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300458 22:50077253-50077275 TTTCTGAGACCCAGGAGAGAGGG 0: 1
1: 0
2: 2
3: 35
4: 373
1185300438_1185300457 26 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300457 22:50077252-50077274 GTTTCTGAGACCCAGGAGAGAGG 0: 1
1: 0
2: 1
3: 47
4: 384
1185300438_1185300459 28 Left 1185300438 22:50077203-50077225 CCAGCGGCCGCCAACCCCTCACC 0: 1
1: 0
2: 0
3: 13
4: 250
Right 1185300459 22:50077254-50077276 TTCTGAGACCCAGGAGAGAGGGG 0: 1
1: 0
2: 2
3: 49
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185300438 Original CRISPR GGTGAGGGGTTGGCGGCCGC TGG (reversed) Intronic
900429600 1:2595491-2595513 GGTGAGGGGCTGGGGGGCTCCGG + Intronic
902861795 1:19251924-19251946 GGTGAGGGCTTCGGGGCGGCGGG + Intronic
905066827 1:35192043-35192065 GGCGGGGGATTGGCCGCCGCCGG - Intronic
905995916 1:42380640-42380662 GGTGGGGGGCTTGCGGCGGCGGG - Intergenic
906510134 1:46405977-46405999 GGTGTGGGGATGGCGGCGGGTGG + Intronic
907454976 1:54569598-54569620 GGTGAGGGGTTGGGGGGTGAAGG - Intronic
907614066 1:55905924-55905946 GGTGAGTGGTTGAGGGCAGCAGG + Intergenic
908517795 1:64911189-64911211 GGTGAGGGATTTGGGGCCACAGG + Intronic
908598111 1:65710143-65710165 GATGAGGGGTTGGGGGGCACAGG - Intergenic
912776807 1:112510574-112510596 GGTGAGGGGTAGCTGGCCGAGGG + Intronic
915141968 1:153773464-153773486 TGTGAGGGGCTGGAGGCCCCAGG - Exonic
915156009 1:153876928-153876950 GGTGAGGGGAGGGCGGCGGGTGG + Intronic
916240228 1:162632107-162632129 GGTGTGGGGTAGGCGGCGGGGGG + Intronic
916963319 1:169910684-169910706 TGAGAGGGGTTGGGGGGCGCAGG - Intergenic
919001359 1:191835009-191835031 GGTGGGGGGTTGGTGGGAGCAGG + Intergenic
919789850 1:201284005-201284027 GGCGAGGGGCTGCCGGCCCCAGG + Intronic
919914738 1:202132495-202132517 GGTGAGGGGCTGGAGGGCCCAGG + Exonic
920505668 1:206513625-206513647 GGGGAAGGGCTGGCGGCAGCTGG + Intronic
922774592 1:228208855-228208877 GCTGAGGGGTGGGCGGCTGTGGG + Intronic
923007861 1:230066889-230066911 GCTGAGGGGCGGGCGGCCGGGGG + Intronic
923670283 1:236034611-236034633 GGTGAGGGCTTGACAGCGGCTGG + Intronic
924090188 1:240493378-240493400 GGCGAGGGGATGGCGCCCGCCGG + Exonic
924239276 1:242025602-242025624 TGTGAGGGGTTGGCTGCCCTTGG + Intergenic
1063057206 10:2518837-2518859 GGTGAGGAGGTGTCGGCCGCAGG + Intergenic
1063995052 10:11611395-11611417 CGTGAGGGGCCGGCGGCGGCGGG - Intronic
1064230809 10:13528534-13528556 GGTGCGGGGAAGGCGGCGGCGGG + Intronic
1064504042 10:16010045-16010067 GGTGAGGGGATGGCAGCAGCTGG - Intergenic
1065342733 10:24722846-24722868 GGGGAGGCGTGCGCGGCCGCGGG + Intronic
1067736896 10:48862681-48862703 GGTGAGGGGTTGGAGGAAGATGG - Intronic
1069279598 10:66638422-66638444 GCGGAGGGGTGGGCGGCGGCGGG - Intronic
1069985059 10:72277319-72277341 TGTGAGGGGTGGGTGGCGGCAGG + Intergenic
1070610152 10:77927056-77927078 GGGGAGCGGGTGGCGGCCGCGGG - Intergenic
1071554440 10:86591612-86591634 GGTGAGGGGCTGGGGGCTGGAGG + Intergenic
1071579475 10:86756558-86756580 GGGGAGGGGCGGGCGTCCGCGGG - Intergenic
1072656807 10:97335114-97335136 GGGGAGGGGCGGGCCGCCGCGGG + Intergenic
1073080068 10:100854098-100854120 GGTGAGGGGTTGAGGGGCCCGGG - Intergenic
1073149530 10:101302341-101302363 GGTGAGGAGTTGGGGGGCACAGG + Intergenic
1074443257 10:113497196-113497218 GGGAAGGGGTTGGAGGCCCCGGG - Intergenic
1076708908 10:132320395-132320417 AGTGAGGGGTGGGGGTCCGCTGG + Intronic
1076824817 10:132961602-132961624 GGTGAGGGGTGGGGAGCCCCCGG - Intergenic
1076824870 10:132961764-132961786 GGTGAGGGGTGGGGGATCGCCGG - Intergenic
1078667728 11:13340279-13340301 GCTGAGGGGTGGGCTGCCCCAGG - Intronic
1078715843 11:13838362-13838384 GGTGAGGGGCTGGCCTCTGCAGG - Intergenic
1080551352 11:33376271-33376293 GGAACGGGGGTGGCGGCCGCGGG - Intergenic
1083270083 11:61567796-61567818 GGTGAGGGGGCGGCGGGGGCCGG - Intronic
1083302568 11:61746574-61746596 GGTTAGGGGTGGGCTGCCCCTGG - Exonic
1083753998 11:64779171-64779193 GGGGAGGGGCTGGCGCGCGCCGG + Intergenic
1083782626 11:64925992-64926014 GGGGAGGGGTGGGAGGCAGCGGG + Intronic
1084004987 11:66317857-66317879 GGTGAGGGGAGGGCAGCCCCTGG - Intergenic
1087034303 11:93741177-93741199 GGTGAAGGGATCACGGCCGCAGG - Intronic
1087182027 11:95150821-95150843 GCTGAGGGGTCGGCGCCGGCGGG - Intergenic
1088823350 11:113474866-113474888 GGAGAGGGGATAGCAGCCGCGGG + Intronic
1090405896 11:126475678-126475700 GGTGTGGGGTGGGCGGCTGGGGG - Intronic
1092105907 12:5921644-5921666 TGTGAGGGGTTTGCTGCTGCAGG - Intronic
1092280749 12:7096274-7096296 GGTGGGGGGTTGGGGGAGGCAGG - Exonic
1092906033 12:13101375-13101397 CATGGGTGGTTGGCGGCCGCGGG - Intronic
1094006829 12:25762533-25762555 GGTCAGGGGTTGGGGGAGGCAGG - Intergenic
1096078395 12:48818593-48818615 GGCGAGGGGGCGGCGGCCACCGG - Intronic
1096792175 12:54052207-54052229 GGCGCAGGGCTGGCGGCCGCTGG - Intronic
1102037668 12:109781475-109781497 GGTGGGGGGTTGGAGCCCCCTGG + Intergenic
1102547211 12:113665798-113665820 GGGGAGAGGTTGGGGGTCGCAGG - Intergenic
1102574980 12:113850491-113850513 GGTGTGGGGTTGACAGCTGCAGG + Intronic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1103698454 12:122835340-122835362 GGCGAGGCGTTTGCGGGCGCGGG + Intronic
1103703624 12:122860210-122860232 GGTGAGGGGCCGGCGGCAGCAGG + Exonic
1103940940 12:124500821-124500843 GGTGAGGGGCAGGCGGGGGCTGG + Intronic
1104980173 12:132570128-132570150 GCTGCGGGGGTGGCGGCTGCGGG - Exonic
1105956563 13:25288247-25288269 GGTGGGGGGGTGGCGGCGGGGGG + Intergenic
1107722832 13:43267114-43267136 GGAGAGGGGTGGGCTGCAGCGGG - Intronic
1109888480 13:68575201-68575223 GGCGAGGGGTTGGGGGATGCGGG + Intergenic
1110354836 13:74555468-74555490 GGTGATGGGCTGGCGGCCCTGGG - Intergenic
1113119738 13:106913623-106913645 GGTGAGGGGCAGGCAGCCGGTGG - Intergenic
1113582292 13:111438006-111438028 GCTGAGGGCATGGCGGCCGAGGG + Intergenic
1113846428 13:113394183-113394205 GGCGCGGGGTAGGCGGGCGCGGG + Intergenic
1114524493 14:23359519-23359541 GGGGAGGGGCTGGGGGCCTCAGG + Exonic
1114944554 14:27663442-27663464 GGTATGGGGTTGGGGGCAGCAGG + Intergenic
1116755296 14:48940791-48940813 GGTGTGGGGTTGGGGGACGGGGG - Intergenic
1121886780 14:97550393-97550415 GGTGAGGGGTTGCGGGCGGGAGG + Intergenic
1121906647 14:97752123-97752145 GGTGAGGGATTGGGTGCCTCTGG - Intronic
1122543295 14:102509481-102509503 GAGGAGGGGGCGGCGGCCGCGGG + Intronic
1123023404 14:105412501-105412523 TGTGAGGAGCTGGCTGCCGCAGG + Exonic
1123208231 14:106734715-106734737 GTGGAGGGGATGGTGGCCGCCGG + Intergenic
1129874151 15:78961714-78961736 GGTGGGGGGTGGGGGGCGGCGGG - Exonic
1130525735 15:84704774-84704796 GGTGAGGGTTTGGCTGCCACAGG - Intronic
1131111420 15:89767320-89767342 GGTGGGGGGTGGGAGGCTGCAGG - Intronic
1132938833 16:2496907-2496929 GGTGAGGGCCGGGCAGCCGCTGG + Exonic
1135016177 16:18926471-18926493 GGGGCGGGGTTGGCGCCCGCCGG + Intergenic
1135239133 16:20787901-20787923 GGTGAGGGGTTGTCGGGGGGTGG - Intronic
1136375756 16:29864086-29864108 GGTGAGGGGTAGGGGGTTGCGGG + Intergenic
1138360579 16:56424879-56424901 GGGGAGGGGGAGGGGGCCGCGGG - Intronic
1138548555 16:57734828-57734850 GGTGAGAGGCTGGAGGCCGAAGG + Intergenic
1141132442 16:81445143-81445165 GGTGGGGGGGTGCGGGCCGCCGG + Intergenic
1142173554 16:88634860-88634882 GGAGATGGGGCGGCGGCCGCTGG + Intergenic
1142666652 17:1467458-1467480 GGTGAGGCGCGGGCGGCCCCCGG - Exonic
1142671948 17:1491565-1491587 GGCGCGGGGACGGCGGCCGCGGG - Intronic
1143179156 17:4973545-4973567 GGTGAGGGCTGGGCAGCCTCTGG - Intronic
1145878235 17:28335774-28335796 GCTGAGGGGCAGGCGGCTGCAGG + Exonic
1145937955 17:28726193-28726215 TGTGTGGGGCTGGCGGCCGGCGG - Exonic
1146911928 17:36653810-36653832 GGGCAGGGGCTGGCGGCCCCTGG + Intergenic
1146947613 17:36884653-36884675 GGTGAGGGGTTGTCAGACGGAGG + Intergenic
1147247716 17:39133043-39133065 GATGATGGGTTGGCGGCAGAGGG - Intronic
1148262091 17:46193020-46193042 GGGGAGGGGAAGGCGGCGGCGGG + Intronic
1148419252 17:47531657-47531679 GGTCGGGGCTGGGCGGCCGCAGG + Intronic
1150239650 17:63621868-63621890 GGTGAGGAGTAGGCGGCTGCAGG - Intergenic
1151612322 17:75184168-75184190 GGGGAGGGGTTGGAGACAGCTGG - Intergenic
1151704344 17:75758699-75758721 GGTGAAGGGTGGAAGGCCGCGGG + Intronic
1151938963 17:77281214-77281236 GGAGCGGGGCTGGCGGGCGCCGG - Intronic
1152230289 17:79110936-79110958 GGTGAGGGGTAGGCCGTGGCTGG - Intronic
1152627378 17:81393836-81393858 GGTGGGGGGCTGCGGGCCGCGGG - Intergenic
1155209159 18:23586265-23586287 GGTGAGCGGTCGCCGGCCACCGG - Exonic
1157102254 18:44741778-44741800 GGTGAGGAGTTGGCAGGCACCGG - Intronic
1157106292 18:44777516-44777538 GATGAGGGGATGGCAGCCCCAGG - Intronic
1157220440 18:45825408-45825430 TGTGAGGGGATGGCAGCCACAGG + Intergenic
1157284043 18:46365008-46365030 AGTGAGGGGTTGGGGGTCTCTGG + Intronic
1159359410 18:67381409-67381431 GGTGGGGGGTGAGGGGCCGCAGG + Intergenic
1160024803 18:75208821-75208843 GGCGTGGGGTTGGGGGGCGCCGG + Intronic
1160787802 19:909382-909404 GGTGGGGGGTTGGGGACTGCTGG - Intronic
1160799511 19:961226-961248 GGGGAGGGGTGGGCGGAGGCTGG - Intronic
1161129480 19:2579582-2579604 GGCGAGGGGACGGCCGCCGCTGG + Intronic
1161208981 19:3056558-3056580 GGAGAGGGGCAGGGGGCCGCTGG + Intronic
1161672416 19:5621745-5621767 GGTGAAGGGCTGGCCACCGCTGG + Intronic
1161800808 19:6415930-6415952 GGTGCGGGGGTGGCCGCAGCCGG + Intronic
1162140847 19:8584943-8584965 GCTGCGTGGTGGGCGGCCGCAGG + Exonic
1162292768 19:9792115-9792137 GGTGAGGGGGAGGCGGGGGCGGG - Intronic
1163138765 19:15332330-15332352 GGGGAGGGGGCGGCGGCAGCGGG - Intronic
1165255867 19:34576999-34577021 GGGGAGGGGTGGGAGGCCGAAGG + Intergenic
1165423464 19:35733305-35733327 GGGGAGGGGGTGGCGGGGGCGGG - Exonic
1166092568 19:40519738-40519760 GGCGAGGCGGTGGCGGCAGCAGG + Exonic
1166365170 19:42274466-42274488 GGTGAGGGGTGGAAGGCCACAGG - Intronic
1166485386 19:43207174-43207196 GGTGTTAGGTTGGCGGCTGCGGG + Intronic
1166852850 19:45768693-45768715 GGTGAGGCGGCGGCGGCGGCCGG - Exonic
1166948601 19:46412162-46412184 GGTGAAGGGTTGGGCGCCGAGGG - Exonic
1167037262 19:47001778-47001800 GGTGGGGGGTTGGGGACAGCTGG + Exonic
1167501696 19:49851703-49851725 GGTGGGGGGTTGGGGGACGGGGG + Intronic
925313797 2:2906775-2906797 GGTGTAGGGTGGGCGGCTGCGGG - Intergenic
925313954 2:2907184-2907206 GGTGTAGGGTTGGCGGCTGTGGG - Intergenic
926206628 2:10838475-10838497 GGTGAGGAGTGGGCTGCAGCGGG + Intergenic
927972291 2:27313254-27313276 GGTGAGGGCTTTGAGGCAGCAGG - Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928082370 2:28322654-28322676 GGGCTGTGGTTGGCGGCCGCAGG + Intronic
931762907 2:65432422-65432444 GGGGAGCGGTCGGCGGCCGGGGG + Intronic
932485488 2:72081960-72081982 GGTGTGGGGGTGGGGGCAGCAGG - Intergenic
933689980 2:85172307-85172329 GGTGTGGGGGTGGTGGCCACAGG - Intronic
934978498 2:98822470-98822492 CGCGAGGGGCAGGCGGCCGCTGG + Exonic
937308869 2:120889052-120889074 GGTGATGGGTTGGGCGCTGCAGG + Intronic
938458592 2:131483033-131483055 GGTGTGGGGTTGGGTGCAGCAGG + Intronic
943706915 2:191045535-191045557 GGTGGGGGGTTGGAGGTGGCAGG + Intronic
944831243 2:203535463-203535485 AGTGAGTGGTTGGCGGCGGGCGG - Intergenic
945299255 2:208200510-208200532 GGTCAGGAGTTGGAGACCGCTGG - Intergenic
946702043 2:222424270-222424292 GGTGGGGGGTTGGGGGCGCCGGG + Intergenic
948244235 2:236464825-236464847 AGTGCGGGGTTGGCGGCAGGGGG - Intronic
948654153 2:239466341-239466363 GGTGACAGGTTGGAGGCCTCAGG + Intergenic
948768706 2:240236460-240236482 GGTGAGGGGATGGCTGCTGGTGG - Intergenic
949034992 2:241812186-241812208 TGTGAGGGGTTGGCGGGGGTGGG + Intronic
949035673 2:241814755-241814777 GGGGCGGGGGTGGCGGCGGCAGG + Intronic
1169141825 20:3230911-3230933 GGTGAGGGGCTGGCGGTGGGCGG - Exonic
1171171959 20:23023423-23023445 GGTGAGGGGTGGGGGACCGCAGG + Intergenic
1172274871 20:33673997-33674019 GCTGAGGGGTGGGAGGCAGCAGG + Intronic
1174343855 20:49915358-49915380 GGTGAGTGACGGGCGGCCGCGGG - Intronic
1175200339 20:57272693-57272715 GGTGATGGGTTGGGGGAGGCTGG - Intergenic
1175373646 20:58509927-58509949 GGTCAGGGGTTGGCAGGGGCTGG - Intronic
1175801608 20:61804228-61804250 GGTGAGGGGCTGGCCTCTGCAGG + Intronic
1176143940 20:63557216-63557238 GGTGAGCGGTGGGGGGACGCAGG - Intergenic
1176179444 20:63742525-63742547 GGGGCGGGGCAGGCGGCCGCAGG - Exonic
1176230627 20:64030989-64031011 GGAGAAGGGATGGCGGGCGCTGG - Intronic
1176411957 21:6453967-6453989 GGTGAGTGGGTGGCGGGCACGGG - Intergenic
1177655488 21:24011279-24011301 GGTGTGGGGTTGGGGGTAGCAGG + Intergenic
1179213618 21:39348745-39348767 GGCGAGCGCTCGGCGGCCGCGGG - Intronic
1179529602 21:42009818-42009840 GGGCAGGGGTTGGGGGCCGGCGG - Intronic
1179687451 21:43062289-43062311 GGTGAGTGGGTGGCGGGCACGGG - Exonic
1180824038 22:18851031-18851053 GGTGAGGGAAGGGCTGCCGCTGG - Intronic
1181124464 22:20694185-20694207 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181188699 22:21123517-21123539 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1181210500 22:21286976-21286998 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181650409 22:24256144-24256166 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1185037910 22:48489392-48489414 GGCGCGGGGTCGGCGGGCGCGGG + Intergenic
1185288399 22:50012425-50012447 GGTGAGGGGTTGCAGGGCCCTGG - Intronic
1185300438 22:50077203-50077225 GGTGAGGGGTTGGCGGCCGCTGG - Intronic
1203216447 22_KI270731v1_random:8454-8476 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1203274179 22_KI270734v1_random:76935-76957 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
949480974 3:4493540-4493562 GGAGAGGGGTTAGCAGCCGCTGG - Exonic
952834151 3:37590006-37590028 TGTTAGGGGATGGCGGCTGCAGG - Intronic
955200729 3:56850033-56850055 GGTGAGGGGGTGGTGGGTGCGGG - Intronic
958949438 3:100400869-100400891 GGAGTGGGGTGGGCGGCGGCGGG - Exonic
962415851 3:135181261-135181283 CCTGAGGGGTTGGCGGGAGCAGG - Intronic
963827439 3:149970663-149970685 GGAGCGGGGTGGCCGGCCGCGGG - Intronic
968225687 3:196970530-196970552 GGTGAGGGGTTAGCTGCAGAGGG - Intergenic
968441738 4:627828-627850 GGTGAAGGGGTGGTGGCAGCGGG - Intronic
968480682 4:831807-831829 GGTGAGGGGATCACGGCCGGTGG + Intergenic
969330764 4:6472427-6472449 GGTGGGCGGGCGGCGGCCGCGGG + Intronic
970350451 4:15196809-15196831 GGTGAGGGCTTGGGGGCTGTGGG - Intergenic
971351732 4:25862303-25862325 GGTGGGGGGTTGGGGGGTGCTGG + Intronic
972396727 4:38664341-38664363 CGGGCGGCGTTGGCGGCCGCAGG - Exonic
975983667 4:80184563-80184585 GGGGAGGGTTTGTCGCCCGCCGG + Intronic
976019935 4:80610312-80610334 GGTTAGGGGTTGGGGGACACTGG - Intronic
984719775 4:182958916-182958938 GGTGAGGAGATGGGGGCCTCAGG - Intergenic
985521663 5:376636-376658 GGCGAGGGGGCGCCGGCCGCAGG - Exonic
986404944 5:7416312-7416334 GGAGAGGTGATGGCGCCCGCCGG - Intronic
987362519 5:17120116-17120138 GGTGGGGGGGTGGGGGCTGCTGG + Intronic
988927482 5:36004246-36004268 GGTGGGGGATTGGGGGGCGCCGG - Intergenic
989170898 5:38469622-38469644 GGAGAGGGGTATGGGGCCGCAGG + Intergenic
990039191 5:51358376-51358398 GGTGAGGTGGAGGAGGCCGCAGG - Intergenic
991351257 5:65722345-65722367 GCTGAGAGGCTGGCGGCGGCGGG - Exonic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
992910781 5:81394136-81394158 GGTGGGGTGTCGGGGGCCGCAGG - Exonic
994778216 5:104062008-104062030 GGTGAGGGGTGGGGGGAGGCGGG - Intergenic
997232989 5:132257493-132257515 GGTGCCGGGTTGCCGGCAGCCGG + Intronic
997261197 5:132466641-132466663 GGGCAGGGGTTGGCAGCTGCTGG + Intronic
998690286 5:144580422-144580444 GGTGGGGGGTTGGGGGGCACTGG + Intergenic
1000312184 5:160055723-160055745 GGTGAGGGGTTAGAGGCCAGAGG + Intronic
1001042936 5:168349744-168349766 GGAGTGGGGTTGGCTGCCGTGGG + Intronic
1001097827 5:168789510-168789532 GGTGAGGGGAGGGGGGGCGCTGG - Intronic
1002140403 5:177134072-177134094 GATGCGGGGTTGGTGGCCGGCGG + Intronic
1002580896 5:180209006-180209028 GGTGAGTGGTGCGCGGCCGAGGG - Intronic
1003098263 6:3158104-3158126 GGAGAGGAGTGGGGGGCCGCGGG + Intergenic
1005841710 6:29748336-29748358 GCTGAGGGGTTGGAGTCTGCAGG - Intergenic
1005871154 6:29975199-29975221 GCTGAGGGGTTGGAGCCTGCCGG - Intergenic
1005968747 6:30744626-30744648 GGGGAGCGGTTGGCAGCAGCGGG + Intergenic
1006058760 6:31404250-31404272 GCTGAGGGGTTGGAGTCTGCAGG + Intronic
1006071245 6:31499135-31499157 GCTGAGGGGTTGGAGTCTGCAGG + Intronic
1006452393 6:34112664-34112686 GGGAAGGGGTTGGAGGCGGCAGG + Intronic
1007761096 6:44134230-44134252 AGTGTGGGGGTGGCGGCGGCAGG + Intronic
1010126983 6:72443871-72443893 AGTGAGGGGTTGGCGGAAGGTGG + Intergenic
1013155670 6:107489840-107489862 GGCGGGGAGGTGGCGGCCGCGGG + Intergenic
1017113383 6:150953366-150953388 GGTGTGGGGGTGGAGGCAGCCGG - Intronic
1017611269 6:156188833-156188855 GGTGAGAGGTGGGCAGCAGCAGG + Intergenic
1019323738 7:427362-427384 GGTGAGGGTTTGGGAGACGCAGG - Intergenic
1023638590 7:42237120-42237142 GGTGCGGCGCGGGCGGCCGCGGG + Intronic
1023860906 7:44217319-44217341 GGTGTGGTGGTGGCGGCCGCTGG - Exonic
1025210632 7:57018016-57018038 GGTGAGGGGGTGGGGGAGGCAGG - Intergenic
1025520795 7:61726811-61726833 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025545152 7:62156372-62156394 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025661324 7:63558831-63558853 GGTGAGGGGGTGGGGGAGGCAGG + Intergenic
1026867639 7:73833292-73833314 GGTGAAGGGTTGGGGACCCCAGG + Intergenic
1028667404 7:93362696-93362718 GGTGAGGGGTGGTCAGACGCTGG + Intergenic
1029292436 7:99512514-99512536 GGTCAGGGGATGGGGGCTGCAGG - Exonic
1029488446 7:100857210-100857232 GGTGAGGGGTGGGCAGACGTCGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1034978224 7:155460023-155460045 GTTGAGGGTTTGGGGGCAGCGGG - Intronic
1035188049 7:157141052-157141074 GCAGAGGGGTTGGTGGCTGCAGG + Intronic
1035235887 7:157497559-157497581 GGTGTGGGCCTGGCGGCTGCGGG - Intergenic
1035529869 8:342768-342790 GGTGAGGGGTGGGTGGGGGCGGG + Intergenic
1039456490 8:37710871-37710893 GGAGAGGGGTCGGGGGCGGCAGG - Intergenic
1039548810 8:38428950-38428972 GGAGAGGTGTTGGCAGCTGCTGG - Intronic
1039567982 8:38564753-38564775 GGTGAGGCGGTGGGGGCCGGTGG - Intergenic
1041099470 8:54381691-54381713 GGGGAGGGGGTGGCGGACGAGGG + Intergenic
1043388278 8:79768397-79768419 GGCGGGGGCTGGGCGGCCGCCGG + Intergenic
1045296118 8:100872896-100872918 GGGGTGGGGTGGGAGGCCGCAGG + Intergenic
1045815191 8:106270396-106270418 GGCGAGGGCTTGGCGCCCGGGGG + Intronic
1049364914 8:142232474-142232496 AATGAGGGGAGGGCGGCCGCAGG + Intronic
1049412900 8:142481375-142481397 GGGGAGGGGTTGGAGACCCCCGG - Intronic
1050081553 9:1921186-1921208 GCTGAGGAGTTGGAGGCTGCAGG - Intergenic
1051146206 9:14030208-14030230 GGGGGGGGGGTGGCGGCGGCGGG + Intergenic
1052857688 9:33417296-33417318 GGTAAGGGGTTTGGGGGCGCTGG - Intergenic
1056489699 9:87093330-87093352 GGGGAGGGGTGGGTGGCAGCAGG + Intergenic
1056711022 9:88991730-88991752 GGTGGGGGGCTGGGGGCCGAAGG + Intronic
1061261337 9:129482487-129482509 CGTGGGGGGTCGGGGGCCGCGGG + Intergenic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1061967758 9:134025628-134025650 GGCGCGGGGATGGGGGCCGCGGG + Intergenic
1062049316 9:134438881-134438903 TTTCAGGGGTTGGCGGCCGGGGG - Intronic
1062119595 9:134827222-134827244 GGTAAGGGGATGGCGGTCCCTGG - Intronic
1062397909 9:136359925-136359947 GGTGCTGGGTGGGCGGCAGCAGG - Intronic
1192440395 X:71169770-71169792 GCTGAGGGCTAGGCTGCCGCAGG - Exonic
1194663904 X:96656166-96656188 GGTGAGGCGCTGGCCGGCGCAGG - Intergenic