ID: 1185302843

View in Genome Browser
Species Human (GRCh38)
Location 22:50091606-50091628
Sequence TACCCAAGAGAGCTGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185302843_1185302845 6 Left 1185302843 22:50091606-50091628 CCCTTCAGCAGCTCTCTTGGGTA 0: 1
1: 0
2: 3
3: 20
4: 176
Right 1185302845 22:50091635-50091657 ATTAGTCTCCATCTTACAGATGG 0: 1
1: 0
2: 2
3: 42
4: 357
1185302843_1185302846 13 Left 1185302843 22:50091606-50091628 CCCTTCAGCAGCTCTCTTGGGTA 0: 1
1: 0
2: 3
3: 20
4: 176
Right 1185302846 22:50091642-50091664 TCCATCTTACAGATGGCAACAGG No data
1185302843_1185302848 29 Left 1185302843 22:50091606-50091628 CCCTTCAGCAGCTCTCTTGGGTA 0: 1
1: 0
2: 3
3: 20
4: 176
Right 1185302848 22:50091658-50091680 CAACAGGCCCAGAGTAGTTAAGG 0: 1
1: 0
2: 0
3: 19
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185302843 Original CRISPR TACCCAAGAGAGCTGCTGAA GGG (reversed) Intronic
901134686 1:6985259-6985281 TGCCCAAGAGAGCTGCTCCCTGG + Intronic
901383842 1:8893510-8893532 TGCCCAAGAGAAAGGCTGAAGGG + Intergenic
902061333 1:13645859-13645881 TTCCCTAGAGAGCTGTTGCAAGG + Intergenic
903441425 1:23390893-23390915 TACCCATGAGCGCTGCTGAGTGG - Intronic
905360733 1:37418386-37418408 TAAGCAAGAGAGGTGCTGAGAGG + Intergenic
908549278 1:65192959-65192981 AACCCATGAGAGCTGCTGAGTGG - Intronic
909163508 1:72185501-72185523 TTCCCAGGAGAGCTGTAGAATGG + Intronic
909455616 1:75845620-75845642 AAACCATGAGAGCTGCTGAGTGG - Intronic
909861144 1:80607199-80607221 TACCTATGAGAGCTGCTGCATGG + Intergenic
910753369 1:90658861-90658883 GACTCAAGAGACCTGATGAAGGG - Intergenic
912310055 1:108611053-108611075 GAACCCAGAGAGCAGCTGAAGGG - Intronic
913073700 1:115323422-115323444 TTCCTTAGAGAGCTGCTGACAGG - Intronic
917621492 1:176801230-176801252 TACCCAAGATTGCTGCTAAGTGG - Intronic
917969064 1:180195700-180195722 TACCCCAGAGGGCTGCTGCTGGG + Intronic
921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG + Intergenic
923224668 1:231927984-231928006 TCCACAGGAGAACTGCTGAAGGG - Intronic
1063207534 10:3848522-3848544 CATCCAACAAAGCTGCTGAAAGG - Intergenic
1063299456 10:4838654-4838676 GACCCAGGGGAGCTACTGAATGG - Intronic
1064428170 10:15248453-15248475 TTCCCAAGAGAGGGTCTGAATGG + Intronic
1066482438 10:35809961-35809983 TACCCAAGAAAGCAGCAGAATGG - Intergenic
1069927436 10:71860523-71860545 TCCCCAAGAGAGCAGCTGATGGG - Intergenic
1070783468 10:79150291-79150313 TTCCCATGAGAGCTGCTGCCAGG + Intronic
1072367970 10:94733708-94733730 TACCCAAGAGCTCTTCTTAATGG + Intronic
1073770653 10:106731755-106731777 TACCCAATAAAGCTACTGGAAGG + Intronic
1075333615 10:121593413-121593435 TGCCCGAGAGAGCTGTGGAAGGG - Intronic
1076462562 10:130656602-130656624 TGCCCTAGAGACCTGCTGATGGG - Intergenic
1079396137 11:20065543-20065565 TTCCCAGGAGAGCTGCTGGATGG + Intronic
1079987883 11:27217444-27217466 TACCAAAGAGGGCCGCTGACAGG - Intergenic
1080159992 11:29162351-29162373 TACCCAACTGATCAGCTGAAGGG + Intergenic
1082105324 11:48215263-48215285 TACCCAAGAAAACAACTGAAAGG - Intergenic
1082902937 11:58275849-58275871 TCCCCCAGAGAGATGATGAATGG - Intergenic
1084798546 11:71526010-71526032 AACCCATGAGAGCAGCTGCAGGG + Intergenic
1084803642 11:71564271-71564293 AACCCATGAGAGCAGCTGCAGGG + Intronic
1088433704 11:109787055-109787077 CACCCTAGAAAGATGCTGAATGG - Intergenic
1088706840 11:112471507-112471529 TAACAAAGAGGGCTGCTGGAGGG + Intergenic
1088764168 11:112960815-112960837 TTCCCAGGGGATCTGCTGAAGGG + Intergenic
1090740724 11:129657892-129657914 CAGCCAAGAGAACTGCTGAGGGG + Intergenic
1091243463 11:134070127-134070149 TATCTCACAGAGCTGCTGAAAGG - Intronic
1091449653 12:564595-564617 AGCCCAGGAGAGCTTCTGAAAGG - Exonic
1091842394 12:3630412-3630434 TACCCTAGGGGGCTGCTGCAGGG + Intronic
1092043566 12:5407288-5407310 TACCCAAGGGACGTGCTCAAGGG - Intergenic
1093790617 12:23245371-23245393 AACCCATGAGAGCTGTTGCATGG + Intergenic
1095109576 12:38277855-38277877 TTCCCAAGAGAGCTGATTACTGG + Intergenic
1097061916 12:56291554-56291576 TGCCAAAGAAAGCTGCTGAATGG + Intronic
1099789544 12:87314792-87314814 TAGCCAAGATAACTGATGAAAGG + Intergenic
1101658838 12:106748260-106748282 CACCCAGGGGAACTGCTGAAAGG - Intronic
1101901642 12:108795224-108795246 CACCCAATAGAGCTGCTGTGAGG - Intronic
1102111807 12:110370899-110370921 AACCCCAGAGAGCTGCTCACGGG + Intergenic
1102382539 12:112479785-112479807 TATCCAGGAGAGCTTCTGAAAGG - Intronic
1104499816 12:129274281-129274303 GACCCAAGAATGCTGCTGCAGGG - Intronic
1105742278 13:23339577-23339599 TACCCATGAAAACTGCAGAATGG - Exonic
1110325794 13:74213803-74213825 TAGCCAAGAGAGCTTGTGAAAGG - Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1114756622 14:25267313-25267335 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
1115147064 14:30238273-30238295 ACCCCAAGGGAGCTGATGAAGGG + Intergenic
1115508350 14:34114344-34114366 TATCCTAGAAAGTTGCTGAATGG - Intronic
1120132347 14:80822525-80822547 TGCCCAAGAGAAAGGCTGAAGGG + Intronic
1121317370 14:92970324-92970346 TTCCCTAGAGAGCTGCTGGGAGG + Intronic
1121322929 14:93003103-93003125 CTCCCAAGGCAGCTGCTGAATGG + Intronic
1124445787 15:29730714-29730736 TGCCCAAGAGAAAGGCTGAAGGG + Intronic
1125589745 15:40846786-40846808 GACCCAGGAGAGCTACTGGAAGG - Intronic
1125727950 15:41877690-41877712 TTCCCAAGCCACCTGCTGAAAGG - Intronic
1126128868 15:45321363-45321385 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
1128381949 15:67119696-67119718 TGCCCAAGAGAGCTTCTGAAAGG + Intronic
1129632644 15:77278466-77278488 TGCCCAAGAGAAAGGCTGAAGGG + Intronic
1130545216 15:84852275-84852297 TAACCAAGACAGCTACTTAATGG + Intronic
1131935235 15:97496973-97496995 TACTCAGGGGAGGTGCTGAAGGG - Intergenic
1133117934 16:3588974-3588996 TAGCCAGGAGAGCTGGGGAAGGG - Intronic
1134031372 16:10995200-10995222 TCCCCAACAGTGCTGCTGAGAGG - Intronic
1135532922 16:23269986-23270008 TTCTCCAGAGAGTTGCTGAAAGG - Intergenic
1135858367 16:26032788-26032810 TGCCCAAGAGAAAGGCTGAAGGG - Intronic
1137062402 16:35803154-35803176 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
1141243960 16:82289497-82289519 TACCCCAGAGAAGTACTGAAGGG + Intergenic
1143017965 17:3901520-3901542 TACCCAAGTCAGCTGTGGAAGGG - Intronic
1143858175 17:9868198-9868220 TCCCCAAGAGCCCTGCTGAAAGG - Intronic
1144405466 17:14948833-14948855 AACCCAAGATAGCTTCAGAATGG + Intergenic
1148526025 17:48336327-48336349 TAACCAAGAGAGCTGCCCTATGG - Intronic
1148598240 17:48873842-48873864 TGCCCAACAGAGCATCTGAAGGG + Intergenic
1151795946 17:76345839-76345861 TGCCCAAGAGAAAGGCTGAAGGG + Intronic
1152943736 17:83186856-83186878 CACCCCAGAGAGCTGCTGTGAGG - Intergenic
1153060180 18:986769-986791 TACTCAAGAGAGTTGCACAATGG + Intergenic
1155481049 18:26287964-26287986 TACCCAAGAGAAATCCTGCAAGG - Intronic
1155488305 18:26371403-26371425 TAGCCAACAGAGCTCCTGAAGGG - Intronic
1155923178 18:31626183-31626205 ACCCCAAAAAAGCTGCTGAAGGG - Intronic
1157575197 18:48738911-48738933 TCCCTAAGCGAGGTGCTGAAAGG - Intronic
1157683953 18:49628096-49628118 TAGCAAAGAGAGCTGTTGAGTGG - Intergenic
1158852368 18:61508037-61508059 TATCAAACATAGCTGCTGAATGG + Intronic
1161569408 19:5022320-5022342 TACCCAAGAGAGGTGGTGTGAGG - Intronic
1162479193 19:10918730-10918752 CACCCAAGGAAGCTGCTGAAAGG + Intronic
1166573271 19:43813081-43813103 TACACAAGACATCTCCTGAATGG - Intronic
1167483619 19:49747457-49747479 GACCCAGGAGAACTGCTGGAAGG - Exonic
926166364 2:10523964-10523986 CACCCTAGAGAGCTCCTGAAAGG - Intergenic
926974364 2:18498760-18498782 TACTCAACACAGCTGCTGGAAGG + Intergenic
929871396 2:45762058-45762080 TCCCCTAGAGAGTGGCTGAATGG - Intronic
930017094 2:46978370-46978392 TACCTAATAGAGCTGCTCTAAGG + Intronic
930835791 2:55792282-55792304 TCCCTAAAAGAGCTCCTGAAGGG - Intergenic
930838104 2:55815977-55815999 TCCCTAAAAGAGCTCCTGAAGGG + Intergenic
931122964 2:59241057-59241079 TACCAAAGCCAGCTTCTGAATGG + Intergenic
934860066 2:97757322-97757344 GACCAAATGGAGCTGCTGAATGG + Exonic
935168574 2:100591301-100591323 TGCCCAAGAGAAAAGCTGAAGGG - Intergenic
938169060 2:129058614-129058636 TAGCCAGGAGAGCTCTTGAAAGG - Intergenic
941676537 2:168348595-168348617 TGCTAAAGAGAGCTGCGGAATGG + Intergenic
944322749 2:198366992-198367014 TACCACAGAGCCCTGCTGAAGGG - Intronic
946601547 2:221365354-221365376 TAACCAAGAGAGGAACTGAATGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170087110 20:12545894-12545916 TAAACAAGAGAGCAGCTAAATGG - Intergenic
1170419902 20:16182483-16182505 TAGCCAGGAAAGATGCTGAATGG + Intergenic
1174152824 20:48498054-48498076 CACCACAGAGAGCTGCAGAAAGG + Intergenic
1174258243 20:49275256-49275278 TTCCTAAGAGAGCTGATGAATGG - Intronic
1177454481 21:21318104-21318126 GACCCAAGAGAGTTTCTGAAAGG + Intronic
1177684621 21:24419693-24419715 CACCCTAGAGACCTGTTGAATGG - Intergenic
1180171165 21:46059124-46059146 TACCCCAGTGTGATGCTGAATGG + Intergenic
1182866811 22:33611283-33611305 AACCCATGAGAGCAGCTGCAGGG + Intronic
1183492621 22:38124745-38124767 TGCCCAAGAGGGCTGATAAATGG + Intronic
1184435715 22:44473875-44473897 AACCCATGAGAGCTGCTGTGTGG + Intergenic
1185302843 22:50091606-50091628 TACCCAAGAGAGCTGCTGAAGGG - Intronic
949306251 3:2644424-2644446 GACTCAAGAGAGTTTCTGAAAGG - Intronic
950191637 3:10980748-10980770 TACTCAAGAGAGGTGTTGAGAGG - Intergenic
950260032 3:11536822-11536844 CACCCTACACAGCTGCTGAAGGG - Intronic
953192287 3:40699315-40699337 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
953533677 3:43760183-43760205 TACCCCAGAAAACTGCTGTAGGG + Intergenic
956319045 3:67974918-67974940 TAACCAAAAGAGAGGCTGAACGG - Intergenic
956401767 3:68887368-68887390 AACCCAAGAGAGCTGCTGAGTGG - Intronic
957326387 3:78700621-78700643 TTCCTTACAGAGCTGCTGAAGGG - Intronic
960307457 3:116079223-116079245 CACCCAAGAGAGCAGCTGAAGGG - Intronic
963131815 3:141865256-141865278 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
964108735 3:153067279-153067301 TGCCTAAGAGAAATGCTGAAGGG + Intergenic
967255368 3:187586588-187586610 TACCTAAGAAAACTGGTGAAGGG - Intergenic
969868697 4:10091849-10091871 TTCCCGAGAGAGCTGCAGGAAGG + Intronic
970171975 4:13299433-13299455 CACCCAAGAGAGATGGAGAAAGG + Intergenic
970347710 4:15169678-15169700 CACCCAAGAGAGGTTCTCAAAGG - Intergenic
970406224 4:15766978-15767000 TGCCCAAGAGAACAGCTGAAGGG + Intergenic
970670601 4:18392228-18392250 TGCCCAAGAGACCTGCTGGGAGG - Intergenic
970871439 4:20821095-20821117 CACCCATGAGAGCTGCTGTGAGG + Intronic
971368078 4:25993566-25993588 AACCCAAGAGAACTGCAGAGAGG - Intergenic
973105136 4:46326255-46326277 TCCCCAAGAAAGCTAATGAATGG + Intronic
976987495 4:91320060-91320082 TAACCAAGACAGCTGCTAAGTGG - Intronic
980924265 4:139118997-139119019 TACTAAAGAGAGCTACTTAAAGG + Intronic
981231287 4:142358795-142358817 TTCCCAAGCCAGCTGCTGAAGGG - Intronic
981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG + Intronic
981796921 4:148605880-148605902 AATCCATGAGAGCTGCTGAGTGG + Intergenic
982793825 4:159622220-159622242 TGCCCAAGAGAGCTTTTAAAAGG + Intergenic
982827416 4:160018654-160018676 TACCCAATAGTGCTGTTGTAAGG - Intergenic
984358384 4:178695118-178695140 TAACCAAGAGGGCTACTGAGTGG - Intergenic
992381525 5:76242272-76242294 TGCCCAAGAGAAAGGCTGAAGGG - Intronic
993792280 5:92222880-92222902 TACCCATGAGGGTGGCTGAAGGG + Intergenic
995182785 5:109244618-109244640 TGCCCAAGATACCTGCTCAAAGG + Intergenic
995819908 5:116218272-116218294 TGCCCAAGAGAAAGGCTGAAGGG - Intronic
999869966 5:155739435-155739457 TTCCTAAGAGAGCTGCTTTAAGG + Intergenic
1002319753 5:178367956-178367978 CACCCAGGAGAGCTGCTCTAAGG + Intronic
1004455700 6:15789611-15789633 TACCCCAGAGGGTTGCTGACAGG + Intergenic
1009991044 6:70843104-70843126 TACCCTAAAGAGCTGCTGTCAGG - Intronic
1010727772 6:79354690-79354712 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
1012802108 6:103843558-103843580 AACCCATGAGTGCTGCTGATGGG + Intergenic
1013094472 6:106932023-106932045 TGCCCAAGAGAAAGGCTGAAGGG - Intergenic
1013455857 6:110329177-110329199 CACCCCAGTGAGCTCCTGAAGGG + Intronic
1021096693 7:16542964-16542986 TACCCAAAACAGCTTCTGAGTGG + Intronic
1022675865 7:32498071-32498093 TAACCAAGCGGACTGCTGAAAGG - Intronic
1024276219 7:47679145-47679167 AACCCATGAGAGCAGCTGCATGG + Intergenic
1028093844 7:86736143-86736165 TACCAGAGAGAGCTGGTGTAGGG + Intronic
1028426862 7:90699417-90699439 TACCTAAGAGGGTTGCTGCAGGG - Intronic
1029014947 7:97306258-97306280 TACCCAGGACAGCTGCTCCAAGG - Intergenic
1030949714 7:115774860-115774882 AACCCAAGAGAGCTAGTGTAAGG + Intergenic
1031454018 7:121957296-121957318 TGCCCAAGAGAAAGGCTGAAGGG - Intronic
1034539830 7:151750264-151750286 TACCCAAGAGAACTGCAAACGGG + Intronic
1036703520 8:11029830-11029852 AACCCAAGAGAGATTTTGAAGGG - Intronic
1038380620 8:27089704-27089726 AACCCATGAGAGCTGCAGCATGG - Intergenic
1041955417 8:63553830-63553852 TGCCCATGAAAGCAGCTGAAAGG - Intergenic
1042007783 8:64201680-64201702 TACCCAGGATAGAGGCTGAAAGG + Intergenic
1042564102 8:70095636-70095658 GACTCAACAGAGCTGGTGAAAGG + Intergenic
1044255310 8:90053347-90053369 CACCCAAGAGAGCTTGTGCAGGG + Intergenic
1047169629 8:122479232-122479254 TTCCCAGCAGAGCTGCTGGAAGG - Intergenic
1050276323 9:4004635-4004657 AAACCAAGAGAGCTGCTCAGTGG - Intronic
1050406246 9:5311446-5311468 TGCCCAAGAGAAAGGCTGAAGGG + Intergenic
1055936865 9:81611945-81611967 TCCTCAAGCCAGCTGCTGAAAGG + Exonic
1058009155 9:99956991-99957013 CACCAAAGAGAGCTGTTGAAGGG - Intronic
1059512377 9:114861479-114861501 CACCCAAGAGAGCTGCTTTCCGG - Intergenic
1061411038 9:130421884-130421906 TTCCCCTGAGAGCTGCTGAGTGG + Intronic
1061853124 9:133427766-133427788 TGCCCAAAAGAGCAGCTCAAAGG + Intronic
1185572853 X:1147672-1147694 GGCCCCAGAGAGCTGGTGAATGG - Intergenic
1186638262 X:11428286-11428308 TACCCAGGAGAACTGCTGCGGGG + Intronic
1186902467 X:14071880-14071902 TACCCAAGAGAACTGAAAAAAGG - Intergenic
1187200956 X:17133266-17133288 TGCCCAAGAGAAAGGCTGAAGGG - Intronic
1187944839 X:24416025-24416047 AACCCATGAGAGCTGCTGCTTGG + Intergenic
1190452629 X:50596477-50596499 TACCCAAGGGAGCTGCAGCAAGG - Exonic
1190710260 X:53062955-53062977 AACCCATGAGAGCTGCTGGGTGG - Intronic
1194151841 X:90335391-90335413 AGCCCAAGAGGGCTGCAGAAAGG + Intergenic
1195228607 X:102823429-102823451 AACCCATGAGAGCTGCTGCAAGG - Intergenic
1196904505 X:120418565-120418587 TCCCCAAGGCAGCTGCTGCAAGG + Intergenic
1197023556 X:121718798-121718820 TTCCCTAGAGACCTGTTGAATGG - Intergenic
1197345793 X:125325027-125325049 TACCCAAGGCAACTGCTGCAAGG + Intergenic
1199593378 X:149488305-149488327 GACCCACGAGGGCTGATGAATGG + Intronic
1199598641 X:149527126-149527148 GACCCACGAGGGCTGATGAATGG - Intronic
1199999661 X:153052393-153052415 TCCCCAAGAGAAAGGCTGAAGGG - Intergenic
1200455313 Y:3383391-3383413 AAGCAAAGAGGGCTGCTGAAGGG - Intergenic
1200498198 Y:3912156-3912178 AGCCCAAGAGGGCTGCAGAAAGG + Intergenic
1200767290 Y:7090979-7091001 TGCCCAGGAGACCTGCTGGATGG - Intronic
1200984408 Y:9290539-9290561 TTCCCCAGAGAGCTCCTGCAAGG - Intergenic
1202126033 Y:21569705-21569727 TTCCCCAGAGAGCTCCTGCAAGG + Intergenic
1202152969 Y:21859692-21859714 TTCCCCAGAGAGCTCCTGCAAGG - Intergenic