ID: 1185304942

View in Genome Browser
Species Human (GRCh38)
Location 22:50109852-50109874
Sequence AAGAGAAAGGAAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3642
Summary {0: 1, 1: 0, 2: 27, 3: 373, 4: 3241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185304936_1185304942 26 Left 1185304936 22:50109803-50109825 CCGCACTCTAGCCTGGGCAACAC 0: 9
1: 254
2: 2344
3: 4697
4: 6729
Right 1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG 0: 1
1: 0
2: 27
3: 373
4: 3241
1185304938_1185304942 15 Left 1185304938 22:50109814-50109836 CCTGGGCAACACAGCAAGGCTCT 0: 16
1: 760
2: 11022
3: 45190
4: 108042
Right 1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG 0: 1
1: 0
2: 27
3: 373
4: 3241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185304942 Original CRISPR AAGAGAAAGGAAAAGGAGGC TGG Intronic
Too many off-targets to display for this crispr